Gene detail

Detailed information of KXJ29982.1 in Exaiptasia diaphana

Genomic Location: LJWW01000002.1:1944845...1959130
NR annotation: KXJ29982.1, Poly [ADP-ribose] polymerase 1 [Exaiptasia diaphana]
Species Exaiptasia diaphana · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

KXJ29982.1

ATGACTTGTCTGCAGGACCTTGCAATTAGTACCTTGTTGGCTGAATATGCAAAATCTAACCGATCATCGTGTAAAATGTGCAAGGTTAATATTGGGAAGGATTCGCTTCGTCTAGCCAAGATGGTCCAGTCACCGCATTTTGATGGAAAGATTCCAAATTGGTTCCATTACTCCTGCTTTTTCAAAAAAGTCAAACCAAAAAGTGTCAGCGAAGTTGGAGGAGTGGAATCTCTTCGYTGGGAAGACCAAGAAAAAATTAAGGGCAACATTGGTGGTACTRCAGAGCCTAAGAGCAGTAAAACAACAAAGGGATCAAAAGCTACAGCTTCTGCTGCTRCTGAAGATCCAGATTTGATAGCAGARTATGCCAAGTCAAGCAGAAGCTCTTGCAAAGGTTGYGGRGACAAAATTGAAAAGGGAGAGCTTCGTCTTGCTAAGATGATGGAGCCTTCTTCTGATTCTAATGCGCCAATGAACATTGGACTTATACCCCGATGGCATCATGTTGACTGTTTTGTCAAAGAAAGGACGAACCTTGAGGTTGATCTAACTGTTACTGCAGACTGCTTTACTGGGTTTTCAAAATTAGAGAAAAAAGATCAAGATTTACTCAAAAAGAAACTTGGGGCCAGCAAAGCTACTAAAGGAAAGAAAAGAAAAGTGGAAGAAGAGGAAAAACCTCCAAAGAAACAAAAGACAGAGGAAGAGGAAGCAGAAGAAAAGRCACTGAAGGAACAAAGCAAACTACTGTGGAAAATTAGGGATGACTTGACTGCACATGTTCCAAATGCAACACTACGAGAGATGCTAGAAGATAATGGTCTGAGCACACAGGGTGGAGAAACTTCACTTCTTGATCGCTGTGCAGATGGCATTGCTTTTGGTCAGCTTTTGCCTTGCCCAGAGTGTAAAGATGGCCGTCTAGTGTTCAAGCATGACTGTTATGCATGCACTGGCAACATGTCAGAATGGACAAAGTGCACCTACACAACCCATGATCCAAAGAGAGCAAACTGGATTATATCAAAAGAAATCAAAGAAGAAATTGAATTTCTAAAAAAGCTAAAAGTTAAGAGGAGAAAGAGAATATTCCCTAAAGCAAGCATARAAAAGGCTGCTCAAGCAATTGCAGGAGCTTCAGGTCCACCACCAGACAAACCATTGCTAAACCAGAAAGTTGCCATCATTGGAAAACTCAAGAAAAGCAAGGCAGAATTAACCAATGTGGTTGAGGAACTTGGTGGGAAGGTTGTTGAGAAAGTCAACCCTAAAGTCACTTGCTGTATAAGTAGTGTTGCTGAGGTTGACAAGAAGAGCAAAAAGATGAAAGATGCAGAATCATCTGATGTGCCTGTTGTAACAGAAGACTTTCTTGAAGCAGTTAGAAATGGCCGTGCTGAACTGAAAATACCACAGCACAGCATTGTGCCATGGGGAAAGAACAAGGGCGTAACCAGTGTAGATGGACCAGCTGCTTCCTCAATAGACAAGAAAACAGCTGCGAGGTTCACATCAGGTGTGCATGAAAAGAAAGTGACTTTATCTGTGAARGGAGGTGCAGTTGTTGATCCAGAATCCGGATTAGAGGATGATTGTCATGTGTTAGAAGTAAAGGGTGAAGTGTATAATGCCATACTGGGATTAGTTGATATTGTCAGAGGGACAAACTCCTATTACAAACTACAGATATTGAAGGAAGATAGAGGCAACGAGTGTTACTTGTTTCGTTCGTGGGGRCGTGTAGGGACGTCGATTGGAGGGACGAAGCTTGAGGATCCCGGATCTCAGASGGATGCCGTACAAAGATTTTGTGAATTATACGAGGAAAAAACAGGAAACAGTTGGGCAAATAGAAAATCGTTTGTGAAACACCCTAACCGTTTTTATCCACTAGAGATTGACTATGGACAGGATGAAGAAGAACTCAAGAAAAACAATATTGCGCCCGGAAGTCAGTCTAAACTACCAAAAGAATTACAGAGTTTAATCAAGATGATCTTTGACGTGGAATCAATGAAGAAAGCCATGGTGGAGTTTGAGATTGATTTGAAGAAAATGCCTCTTGGAAAACTAACTCGTCGTCAGATTGAACGAGCCTACAGCACCCTTGGTGAAGCGCAACGGCTGGTTTCTGAAGGAGGCAGTGCAAATGGTATCTTGGATGCCTCAAATAGATTCTACACGCTGATTCCTCATGATTTTGGGATGCGAAAACCGGCGCTGCTGGACAATATGGATCTTATCAACTCCAAAGTCAGTATGCTCGACAATCTCTTGGAGATTGAAGTCGCTTACAGCCTGCTGAAAAGCGGTGGTGATGACGAGAAAGAYCCAATYGATRTCAACTACGAAAAACTAAATACAAAACTAGAGGTTTTGGAGCATTCTTCAACTGAGTTTGAAATGATCAAAGAATACGTAAAGAACACTCACGCCGCGACTCACCAGCAATATTCACTGAAGCTGCTCGATGTGTTCAAAGTGGAGMGAGATGGCGAAGCGTCCAGGTACAAGCCKTTYAAAGAGCTCCACAATCGTCAGCTGTTATGGCACGGTTCATCGAACACAAATTATGCTGGAATCCTATCTCAAGGGCTTCGCATTGCTCCTCCCGAGGCCCCTGTGACTGGCTACATGTTTGGCAAAGGTGTCTATTTTGCAGATATGGTATCAAAGTCTGCTAACTACTGYCGCACTACGCCAACTAATAACACGGGTCTTCTTCTCCTCTGTGAAGTTGCTCTTGGAAATATGCACGAGTTAAAAAATGCCAGCTTTATCACCAAACTACCGAAAGGAAAACACAGCGTAAAAGGTCTAGGCAGTACCCACCCTAACCCCGGTGGCTCAATAACWCTAGACGAYGGGACGATAGTGCCAAAGGGAAAAGGTACCGACTCTGGCGTCGACAGGACAAGCTTACTGTACAACGAATACATCGTCTATGACGTTTCTCAAATCAACATCAAGTATTTGCTCAAGACAGAATTCAAGTACAAGTATGGTTGGTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P26446	Poly [ADP-ribose] polymerase 1 OS=Gallus gallus OX=9031 GN=PARP1 PE=1 SV=2
P09874	Poly [ADP-ribose] polymerase 1 OS=Homo sapiens OX=9606 GN=PARP1 PE=1 SV=4
P27008	Poly [ADP-ribose] polymerase 1 OS=Rattus norvegicus OX=10116 GN=Parp1 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001312 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08063 all species →	PADR1_Zn_ribbon	PADR1 domain, zinc ribbon fold	Domain	Interproscan
PF00645 all species →	zf-PARP	Poly(ADP-ribose) polymerase and DNA-Ligase Zn-finger region	Domain	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF00644 all species →	PARP	Poly(ADP-ribose) polymerase catalytic domain	Family	Interproscan
PF21728 all species →	PADR1_N	PADR1, N-terminal helical domain	Domain	Interproscan
PF05406 all species →	WGR	WGR domain	Domain	Interproscan
PF02877 all species →	PARP_reg	Poly(ADP-ribose) polymerase, regulatory domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004102 all species →	Domain	Poly(ADP-ribose) polymerase, regulatory domain	Interproscan
IPR036957 all species →	Homologous_superfamily	Zinc finger, PARP-type superfamily	Interproscan
IPR038650 all species →	Homologous_superfamily	PADR1, C-terminal domain superfamily	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR012982 all species →	Domain	PARP1-like, PADR1 domain, zinc ribbon fold	Interproscan
IPR012317 all species →	Domain	Poly(ADP-ribose) polymerase, catalytic domain	Interproscan
IPR001510 all species →	Domain	Zinc finger, PARP-type	Interproscan
IPR008893 all species →	Domain	WGR domain	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR050800 all species →	Family	ADP-ribosyltransferase diphtheria toxin-like	Interproscan
IPR008288 all species →	Family	Poly [ADP-ribose] polymerase	Interproscan
IPR036930 all species →	Homologous_superfamily	WGR domain superfamily	Interproscan
IPR003034 all species →	Domain	SAP domain	Interproscan
IPR049296 all species →	Domain	PARP1-like, PADR1 domain, N-terminal helical subdomain	Interproscan
IPR036616 all species →	Homologous_superfamily	Poly(ADP-ribose) polymerase, regulatory domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10459 all species →	DNA LIGASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003950 all species →	Molecular Function	NAD+-protein poly-ADP-ribosyltransferase activity	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0070212 all species →	Biological Process	protein poly-ADP-ribosylation	Interproscan
GO:1990404 all species →	Molecular Function	NAD+-protein ADP-ribosyltransferase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24070	PARP1; poly [ADP-ribose] polymerase 1	EC:2.4.2.30	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of KXJ29982.1 across 72 RNA-seq samples of Exaiptasia diaphana. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

72Samples

63TPM > 0

2Conditions

14.9Max TPM

7.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
whole animal · aposymbiotic	36	32	6.48	11.35
whole animal · symbiotic	36	31	8.57	14.85

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR6202344	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	11.35
SRR6202242	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.43
SRR6202259	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	10.25
SRR6202237	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.59
SRR6202260	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.14
SRR6202234	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.11
SRR6202261	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	9.05
SRR6202210	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.90
SRR6202233	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.89
SRR6202205	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.84
SRR6202241	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.57
SRR6202258	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.43
SRR6202346	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.32
SRR6202212	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.30
SRR6202208	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	8.03
SRR6202254	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.98
SRR6202363	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.82
SRR6202206	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.17
SRR6202255	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	7.01
SRR6202235	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.75
SRR6202236	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.73
SRR6202238	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.72
SRR6202207	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	6.01
SRR6202211	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.33
SRR6202209	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.10
SRR6202257	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	5.01
SRR6202240	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.90
SRR6202204	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.67
SRR6202239	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	4.08
SRR6202343	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.84
SRR6202203	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.77
SRR6202256	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	3.25
SRR6202345	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202357	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202358	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202364	whole animal · aposymbiotic	whole animal	not recorded	aposymbiotic	SRP120942	0.00
SRR6202347	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.85
SRR6202285	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	14.19
SRR6202352	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.87
SRR6202351	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.71
SRR6202303	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.59
SRR6202306	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.36
SRR6202281	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	13.14
SRR6202304	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	12.50
SRR6202280	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.36
SRR6202284	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	11.28
SRR6202307	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.98
SRR6202305	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.54
SRR6202262	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.38
SRR6202356	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	10.03
SRR6202309	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.62
SRR6202337	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.59
SRR6202355	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	9.18
SRR6202340	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.83
SRR6202279	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.81
SRR6202277	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.81
SRR6202276	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.46
SRR6202341	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.36
SRR6202263	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	8.21
SRR6202310	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.72
SRR6202339	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.66
SRR6202338	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.48
SRR6202350	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	7.23
SRR6202283	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.82
SRR6202308	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.44
SRR6202282	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	6.39
SRR6202278	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	5.00
SRR6202342	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202348	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202349	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202353	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00
SRR6202354	whole animal · symbiotic	whole animal	not recorded	symbiotic	SRP120942	0.00

Source: CnidoSite RNA-seq expression matrices (EDIAP_TPM, StringTie quantification over 72 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.