Gene detail

Detailed information of OS493_000163-T1 in Lophelia pertusa

Genomic Location: scaffold_1:1838886...1866313
NR annotation: KAJ7394357.1, epithelial cell transforming sequence 2 oncoprotein-like [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000163-T1

ATGTCAGGAGGTACACCGCGAACTGCACGGCCAACTTCAGCAAATTACAAGAAATCGCGAAAAAGCGAGGCCATCGCGACACAGAACGAATTAGTTGGCGCGCGAGGAAATACAAAACCGCGAATTTCACCCTCCGTGATCGAGCATGGATTCCACACAGATAAATACAAAACACACTATAGTGCTTGGACGCCAGTTTTAAACAGTGCTTCAAACAGTCAGATTTTTGTTGAACGTTTGGATCTGATCGGACACTGGTTCTCTATGTGGACAGATGCCCAACGAAAGAAATTCCTCACCTTCGTCCTGAAGAAATGCACAAAATCACAAATGAGATTTGTAAATGAAGGCTGGTTCAAGAAGCAACTTCCAATTCACCACTTAGACTATACAACCGTCTTACCACAGTTCATATCCACGTACATCTTTTCTTTCCTGGATCCGAGAAGTCTTTGTCGCGCAGCCAAAGTGTCATGGCACTGGAAGTTTATAAGCGAGCAAGACGTGATCTGGATGCCAAAATGTTTACGGTTTGGCTGGTATTTGCCGTACACGCCAAGTAGTAGAGAGTACGGCTGCTGGAAACATCACTACATCATGTGTACTGGTTCTCTTGATATGGAAGCTCCATCCAGGATGGCAGAAACATATGGTCAATTTGCCGACAACAGTGCAAGAGTGACTCAAGAAAGAGGAAAACATAAAGAATCAGAGAAGAGCAGAAAGACCAGAGAGGTTATATACTACAGAAAAGAAACACGTCGCCCGCCTTGGTTGGACACTGATCCTCAGCCCAGTGACTTGGAGAATGCCAGAAAGGCTTTGCTTTATGAACACAACCCAAACCAGCCTCATTCCTCTGACCAACTGAGAACTGAGAGACTGGGACTGAGTACCAGACCTCTACACAGGAGGTCCCACACAGCTCCTGCACACATGCGTACAGAGAAAATCAGTGGTATTCATGATGTCAATGGAAACGTAATTGAAGAAGGAAAGGAACCCATACATCCTTCAAAGCTGACCCTAACAGAGGCATTAGCTGTTGAATCTGGTGTTGACGAGTCTGTGGTGGAGCAATCATGGGCCAAACCAGCCCCCAGGTCACCTGTGCGACGACAAGACCTCACTTGTGGTATTCATCCTAGTGCACATGATTCAATGTTAGCAACAAGAAACACGCAGGACCTGCGAAACAGCCCTAGTCCTGCAGTGATATTTATCTCGTCTGAAATCCCAGCGTCTGAGTTGTTATTAGAAGCTGTGCTGTTTGGTGTCATAGCAATCCCGTACGACTACGAAGGCACAACACTGGACGCACTGATGGAAAAGTTAAGACTTGCTCTGCAGGGAAGACAGGCCAAGAGCATTGGTGTGTTTGCCTGGGGAGATTCTGGCACTGTACGTCATGCGAAAGGTCAAACGCTGTCAGAAGAGACCGTAAATGAGCCGAGCATGCGACACTTCTGGGAAACTGTGACGACGAGTGTTACAGCACGAGAATTAGGAGGTCACGTGGACATCTTTGTTCCCCTAGTAGAAACAGAACAAGGAATGGATGTTTTGGTGCAGTTGGGTCTATTGACGGACATGCAATTTTCCTGTCCAACTGGATTGACGGGATCTTTCGCTAGAGTGGAAAGTGAATGGCTGTTTGTTCCTGATAGTGGTACTCCTCCGTCTCTGTATTTCAATGAGACAAAACTTGGCGCTTGGTCAAGCACTGTGGATTACATCGAGGAATGCATTGATGTTGTAAAAAAGAACCTCAACAGTTTTTTCACTGAAGAACAAAGGAATCTAGCTAAGCGTTTTGTTGGGCAAATCACGTTTGAAGCCTTAGGGATGGGTGAGGTATACAGAGTGTCGGAGATTGCGTCTGTTCTGGTTGATGCTGTCATCTCTCTGGGAAGGAACAACGCATCCAAAAATTGGAGTGACCCGGTTCAGGGACTTATTGATTGTCTACAGAATCATGGACACAAAGATAAGAGATTAAAGAAAGTTAGGAAAACAATGACAAAACAAGAGGAAGCGACGTCAGACATGGAAGATGTTGATTCTGAGGATGAATTTGAGACAAGAGAATTTGACACTAAAAACCTCGCCCCCAAAGCTGTCACTGGTACGTCAGCCGGTGAAAAAAGGACGCTAGTTGCCCACGAAATCTTGTCAACAGAGTTGACCTACATGAAATGTTTGTCCATAATTCAAGATGTTTTCAAGAAGCCTCTTCAAGCATCCCTTGCTTCAAACAGGGCCATCATCAGCTCCGCCAACATTCAGAGTTTATTTGCTGACAGTGAGACGTTACTGGCTCTTAGTAGTATGCTGGTGAATGACGTGTCCAACCGTTTAGATGAATGGAATTCACATCAAATACTGGGAGACATTTTTCTGAGGTTCACAACCCAGCTGCGGGCTTACACGAATTTTCTCAACAACTATCCTGTCACACTACAAACACTTGAACGGTGCAAAGAACAGAATCCTCAGTTTCGTTCATTTCTCGGTCGCCATGAAAGGCAGCCAAGCACAAAAATGATGAGTTTACCTGAATTGTTGTTTCTCCCAGGAAGGCGAATAAAAAGTTACGTGGAGCTGTTGGAGTCATTCTTGAAGTACACCCCTTCAGATCACGTGGATAGAAGAAACCTTGCCCAGGCCATCGCAAAATTCAAGGACCTTGATAGTTTATTTAGACAGGTTCTCGCAGAGAAAAGTCGCCATTTTGTTCGCGAGGAAGATGTCATTTTACTGTCGACTCCAAACACTGGTAAACAAGTGAAACCAGAGTTTAGAATTTACCAACAAGTTGGTGACCTTGGTTTGTTTTTGTTCAATGACTCGCTGCTGGTGGCGACCTTGACCTTCAAGTTTGTTCCGTTCCAAAGGCTGGTTCAACGAAACTACAAGTTCCAAGCGTGTTTGACGTTGAAGAAACTGAAAGTGGAAAATCTAGCGGATTCAAAATGTAAGCTTGTTAATAGTTAG

Transcript

OS493_000163-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q008S8	Epithelial cell-transforming sequence 2 oncogene-like OS=Homo sapiens OX=9606 GN=ECT2L PE=1 SV=2
Q8IX29	F-box only protein 16 OS=Homo sapiens OX=9606 GN=FBXO16 PE=1 SV=1
Q9QZM9	F-box only protein 16 OS=Mus musculus OX=10090 GN=Fbxo16 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002132 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12937 all species →	F-box-like	F-box-like	Domain	Interproscan
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001810 all species →	Domain	F-box domain	Interproscan
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR036047 all species →	Homologous_superfamily	F-box-like domain superfamily	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR052805 all species →	Family	GEF and Ubiquitin-Proteasome Regulators	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46857 all species →	EPITHELIAL CELL-TRANSFORMING SEQUENCE 2 ONCOGENE-LIKE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_000163-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000163-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

101TPM > 0

7Conditions

5.9Max TPM

1.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	15	1.56	3.88
polyp at pH7 6	18	15	1.28	2.85
coral polyp · control treatment	16	16	2.26	5.16
coral polyp · oil and dispersant treatment	16	15	1.43	5.51
coral polyp · oil treatment	16	16	2.40	5.69
coral polyp · dispersant treatment	16	16	1.62	3.36
Polyp	10	8	1.40	5.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.88
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.41
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.17
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.43
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.32
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.98
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.71
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.69
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.62
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.85
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.33
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.91
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.81
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.95
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.83
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.71
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.58
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.55
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.51
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.35
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.22
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.81
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.82
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.78
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.59
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.40
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.51
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.40
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.14
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.69
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.64
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.53
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.69
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.09
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.46
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.27
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.88
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.50
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.36
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.28
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.83
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.45
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.35
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.94
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.02
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.58
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.94
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.24
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.