Gene detail

Detailed information of OS493_000223-T1 in Lophelia pertusa

Genomic Location: scaffold_1:2488973...2509473
NR annotation: KAJ7394414.1, C-type mannose receptor 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000223-T1

ATGACTCAATGTGAGAACAGTTCAATCTGTGGTCTCCCTCAGTGGGTACCAATTCCAAGCAACGACACTGCCTCCTTTATAACTGATGTCGTTCTGTGCGCCGTCAACGTACCTTTCTGCATCTTTGCTTTTCTCGGAAACCTGGCAGTCATTATAGCTGTTATCAAGACACCCTCACTGCAAAGACCGTGCAATATTCTGCTGTGCAGTCTGGCCACTACAGACTGTTTGACCGGTTTGGTAGCTCAGCCGATATTTGTTGCATGGCGTTTGATGATTCACCGCATCCATGAATCTTGTGATCATCAGGCGGAACTGTTTGAAGTGTATGAAGTGAGTCAAGTAGCCTTTGTAGGATGGTCGTTCACCAATCTCTGCCTTGTTAGCTTTGATCGCCATTACGCCCTCGCAAAACCAGTTCAGTACCGTGCCAACGTGACAAACAAAGATGCAGTATGGGCAGCTACCATAACTGGAATAACCTGGTTGACGTGGGCCATTTTGGCGAGTTTTATTTTATCCGATTTTCCTCAGTATGTGATGACCCTAGCTCATGCAATCATGTCCAGAAGCAGTATTACAGTCCTGCTTCTTTTGGCCTGCAGTCTCGGAAGTGTGATAATTTCAAGTGTTGAAGCCGTCAAATGCGACGATGGCTGGATAAATTTCAGAGAGAGCTGTTACCTCAGGGTAAATACTAAAACGACGTGGTCAAACGCACAGAAGACGTGCGAAGAAAAGGAAGCCAACCTGGTCACTGTTAATAGTAAAGATGAAATGGAGTTTCTTGGATGGCTGATGCGAGACAATGGCGGTTGGAATGGATTGCAAATGAAAGAAGATGGCAAAACCTTAGTTTGGAGCAGCGGAGAAAACAGTGATTATCAGAATTGGGGCAAAGGAGGACCAAAACCGAAGACTAAGTTACAGAGATGCGTTCAAATGGCAACGAAACGAAAAGGCCTCAAGTGGACACTTTCTAGATGCTCAATAAAATACAAGTTCACTTGCGAAAAAGCACCAGAAGTGACTACCGCAGCACCAGAAGTGACTACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTTACTACTGCCGCACAAGAAGTGACTACTGCCGCACAAGCAGTGACAGCTGGACTGCTTAGATGCGACGATGGCTGGATAAAATTCCAAGAGAGCTGTTACCTCCGAGTAAATGATAGAATGAAGTGGTTAGACGCACAGGAGACGTGCGAAGAAAAGGAAGCCAACTTGGTCACTGTTAACAGTGAAGATGAAATGATCTTCCTTGGATCAATAATGGGATCAAAGGGAAGCTGGATTGGGTTGAAAATTAAAGCGAAGAGCATAGATTTACTTTGGAGCAGCGGAGAAACCAGTGATTATAGGAACTGGGCCAAAGCAGGACCAAAGAGAAGGTCCAGGTTACCACGCTGCATTCAGATGGCGGAGAAACGAAAAGGTCTCAAATGGAGAGCGAATAGATGCTCGGTGAAATACAGGTTTATCTGTGAAAAAGCACCAGAAGTGACTACTGCTGCCCCTGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCAGCACCAGAAGTGACAACTGCTGCACCAGAAGTGACTACTGCTGCCCCTGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACAACTGCAGCACCAGAAGTGACAACTGCTGCACCAAAAGTAACTACTGCCGCACCTGAAGTGACTACTGCTGCACCAGAAGAAACTACTGCCACACCAGAAGTGACTACTGCTGCACCAGAAGTAACTACCGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCAGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCAGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCAGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACAACTGCTGCACCAGAAGTGACAACTGTTGCACAAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAGGTGGCAACTGCTGCACCAGAAGTGATACCTGTTGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCTGCACCAGACGTGACTACCGCCGTACCAGAAGTAACTACCGCCGCACCAGACGTGACAACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTAACTACCGCCGAAACAGAAGAAACTACTGCCGCACCAGAAATAACCACTGCTGCACCAGAAGTGACAACTGCTGCACCTGAAGTGACTACTGCAGCACCTGAAGTGACTTCTGCTGCACCAGACATGACTACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTGACAACTGCTGCACCAGAAGTGACAACTGTTGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACCGCCGCACCAGAAGTAACTACCGCCGCACCAGAACTAACAACTGCTACACCAGAAGGAACTACCGCCGAACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAGGTGACTACTGCTGCACCAGAAGTAACTACTGCCGCACCAGAAATAACAACTACTGCACCAGAAGTGACTACTGCAGCACCTGAAGTGACTACTGCCGCACCAGAAGTGACAACTTCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTATCGCCGCACCAGAAGTAACTACTGCCGCACCAGAAGTGACAACTGCCGTACCAGAAGTAACTACTGCCGCACCAGAAGTAACAACTGCTGCACCTGAAGTGACAACTGCTGCACCAGAAGTGACAACTGCCGCACCAGAAGTGACAACTGCCGCACCAGAAGTAACTACTGCCGCACCGGAAGTAACAACTGCTGCACCTGAAGTGACTACTGCTGCACCAGAAGTGACAACTGCCGCACCAGAAGTGACTACTGCTGCACCTGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTAACTACCACCGAACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAGGTGACTACTGCTGCACCAGAAGAAACTACTGCCGCACCAGAAATAACAACTGCTGCACCAGAAGTGACAACTGCTGCACCTGAAGTGACTACTGCAGCACCTGAAGTGACTTCTGCTGCACCAGAAGTGACTACCGCCGCACCAAAAGTGACTACTGCTGCACCAGAAGTGACAACTGCGGCACCAGAAGTAACAACTGCTGCACCTGAACTGACTACTGTTGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTGACTACTGCCGCACCAGAAGTGACAACTGCTGCACCAGAAGTGACAACTGTTGCACCAGAAGTAACAACTGCCGCACCAGCAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACCGCCGAACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACCACCGAACCAGAAGTAACAACTGCCGCACCAGAAGTAACTACCGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCCGCACCAGAAGTAACTACCGCCGAACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTAACTACTGCCGCACCAGAAATAACAACTGCTGCACCAGAAGTGACTACTGCAGCACCTGAAGTGACTACTGCCGCACCAGAAGTGACAACTTCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACCGCCGCACCAGAAGTAACTACTGCCGCACCAGAAGTGACAACCGCCGCACCAGAAGTAACTACTGCCGCACCAGAAGTAACAACTGCTGCACCTGAAGTGACAACTGCTGCACCAGAAGTGACTACTGCTGCACCAGAAGCGACTACTGCTGCAGCAGAAGTAACTACCGCCGCCCAAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACTACTGCCGAACCAGAAGTGACTACTGATGCACCAGAAGTGACTACTGCCGCACCAGAAGTAACAACTGCTGCACCAGAAGTGACAACTGCTGCACCTGAAGTGACAACTGCTGCACCAGAAGTGACTACTGCAGCACCTGAAGTGACAACTGCTGCACCAGAAGTGACTACTGCTGCACCAGAAGTGACTACTGCCGCACCTGAAGTGACAACTGCTGCACCAGAAGTGACTACTGCAGCCTGGATTTCCTTAACTTTAAGGGGGAACAAGCCTGAATTTTATCGAAATGATGATTTGGAGGACTTCTTGGCTCAAAATGATGATTTAGAAGGGGCTCTGAATGATGATCTAGAAGACTTCCTGAGCTCAAGGGGAAACGAGCCCGAATTTTCGCGAGAAATGATGATTTCGACGAAGTCTTGA

Transcript

OS493_000223-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q64449	C-type mannose receptor 2 OS=Mus musculus OX=10090 GN=Mrc2 PE=1 SV=3
Q4TU93	C-type mannose receptor 2 OS=Rattus norvegicus OX=10116 GN=Mrc2 PE=1 SV=1
Q9UBG0	C-type mannose receptor 2 OS=Homo sapiens OX=9606 GN=MRC2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001070 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00059 all species →	Lectin_C	Lectin C-type domain	Domain	Interproscan
PF00001 all species →	7tm_1	7 transmembrane receptor (rhodopsin family)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000276 all species →	Family	G protein-coupled receptor, rhodopsin-like	Interproscan
IPR004089 all species →	Domain	Methyl-accepting chemotaxis protein (MCP) signalling domain	Interproscan
IPR017452 all species →	Domain	GPCR, rhodopsin-like, 7TM	Interproscan
IPR001304 all species →	Domain	C-type lectin-like	Interproscan
IPR052082 all species →	Family	Peripheral myelin sheath structural protein	Interproscan
IPR016187 all species →	Homologous_superfamily	C-type lectin fold	Interproscan
IPR016186 all species →	Homologous_superfamily	C-type lectin-like/link domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23348 all species →	PERIAXIN/AHNAK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0043484 all species →	Biological Process	regulation of RNA splicing	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_000223-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000223-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

5TPM > 0

7Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Max TPM
polyp at pH7 9	18	0	0.00
polyp at pH7 6	18	0	0.00
coral polyp · control treatment	16	1	0.02
coral polyp · oil and dispersant treatment	16	1	0.02
coral polyp · oil treatment	16	2	0.04
coral polyp · dispersant treatment	16	1	0.01
Polyp	10	0	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.02
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.02
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.