Gene detail

Detailed information of OS493_000255-T1 in Lophelia pertusa

Genomic Location: scaffold_1:2887864...2907913
NR annotation: KAJ7394445.1, Nucleolar complex protein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000255-T1

ATGGCGGACGCGAAGAAGAAAAGGAGGTTATGCGACATGGATGCAGAGGAGTTCATGATGCATGGGTTTGATTCAGACGTTAGTGAGGCCGATGACGAACCCATGGACACCGAAAATGTTTCTTCAACAGAAGTGTCTCAAGAGCACAAAAAAAAATCAAAAAGTGCAGACCACAAGAACCAGCTTGCAAGATTACAAGCAAAGGATCCTGAATTCTACAAGTTCTTGAAAGAAAACGACAAAGAGCTGCTGGATTTTAATGACTCAGATACTGGCTCAGAGATGGACGATAACCAAGATGATAATGACGATGATGATCATGATGACGACAATGATGATGATGATGATGATGATGATGAAAACAAAGAAGAAGAAGGCAGCGAGGGTGATGAACCTGAGAAAAAGAATGCAGCAAAGACAAACAAATCAGATGATGAAGAAGATGATGATGAGCTGGATGATGAAGGTGTAAAACGCAAAAAGGATTCTGGTAAACCAGTGACTCTGCAGATGATTAAAGAGTGGAGAACAGGACTTGAGAAAAACTCACTTCATTCACTGAAACAAACCTTGCGAGCATTCCGGTCTGCTGTACATGGTGCTCTGGACATCGGTAGTGACGGCAAATCACAAACACGTTTGACATTCAAAGTTGAGGGAGACACAGTATTCAATGCTATCATTCAGCTTTGTTTGAAACATGTTTACTCTGTGCTGTTTCACCTTGTTGGAGGGACCCACAACAAACATGGAAAAAGAATTCTTCCTTCATCGCATGCAAAGTGGTCTCAGGTTAAAACACCAGTCAAACATTACCTCAATGATGTTCTGCAGTTGCTGCGGACTCTTGCCGAGCCTTCCATGTTGTGTGTAATTCTACGGCATGCACAGCAGTTGACTCCTTATTATGCCTGTTTCCCCAAAGTGGCTAAAGCTTTTATTAAGCGATCAGTCAGAATGTGGAGCCGTGGCGAGGAACATGTCAGGGTACTTGCTTTTCTCGGGATCAGAAATGTTGCTACCATGATGCCTTCTTCACTTCTCGAGTTTTCTGTCAAGCAACTGTACATGAATTTTGTGAAGAATTCCAAGTTCATGTCTCCAAAGACCAGGCCCATCATCACCTTCATGCAGAACTCGCTTGTGGAGGTTTTTAGTTTGGATGATCACCTCACATACCAACATGGCTTCGTTTACATCAGGCAGCTCGCAATTCACCTCAGGAATGCTATTCTGCAGAAAAAGAAGGACTCATATCAGTCAGTATATAACTGGCAGTATATTCACTGTCTTCATCTCTGGTGCCGTGTTGTAAGTGAAGTGAAGAGCAATGGGGTCCTTGATCCGCTTATTTATCCTTTGGTACAGACAGTCATCGGTGCAATCAAACTCGTCCCCGCTGCAAGATATTATCCTCTAAGATTTCATTGTATTCGTTCTTTAAACCTGCTGTCCCAGGCTACAGACACGTACATACCAGTTGCGCCATTTTTATTGGAGGTCCTAGAGTCTGTAGAATTCAACAAGAAAACTAAAATGTCCACAGCAAAGCCCACCGAGTTTTCGTGCATACTGAAAGTTTCCAAACAACAGCTAGGAACTAAACCTTATCAGGATGCTGTTGTGGATCATATCTTTGAATTGCTGCTGGAGTTCTTCTCCGTACATGCGCACTCTATAGCTTTTCCCGAAGTAGCTCTTCCTGCCGTTGTAAGGTTAAGAAAATTCATCAAGACAACAAGCGTTCCAAAATATCGGAAGCAGCTAAAACAGCTTGTTGACAAGATCGAAGAAACTTCTACTGAGGTGACAAACCGCCGCTCCAAAGTGTCTTTCAGCCCAAAGGATATCAGTGAAGTGGAAAGGTGGACGGCTCAGTACAGACAGCAACCAAACGCTATTGTAAAGTTCTACAAGACTTGGAAGGTCATGAAACCCTCCATACAACAACAGGATGAAGAGTTAGCAGAAGGTGAAAACGACGTGAATGAAGAAGATTCGGACGAGGATGAAAAAACAGAAACTTCCAAGGGGAAGAGAAAACAAAGGAGCTCCGAGAAGAAGAACGAGCAAGAGAAGAAAACGATCAAGAAACTTAAAAAGAATACAAAGAAACCCGCGGCTGAAAACATTCCACAGACGACAGTGAATCAATCTATGGATACAGCAGATAAGGAGGACATTGTGAAGGACTTTCAGTTTTCATCTGATGAGGATTAA

Transcript

OS493_000255-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9WV70	Nucleolar complex protein 2 homolog OS=Mus musculus OX=10090 GN=Noc2l PE=1 SV=2
Q3SYU1	Nucleolar complex protein 2 homolog OS=Bos taurus OX=9913 GN=NOC2L PE=2 SV=1
Q9Y3T9	Nucleolar complex protein 2 homolog OS=Homo sapiens OX=9606 GN=NOC2L PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003731 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03715 all species →	Noc2	Noc2p family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005343 all species →	Family	Nucleolar complex protein 2	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12687 all species →	NUCLEOLAR COMPLEX 2 AND RAD4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000122 all species →	Biological Process	negative regulation of transcription by RNA polymerase II	Interproscan
GO:0003714 all species →	Molecular Function	transcription corepressor activity	Interproscan
GO:0005654 all species →	Cellular Component	nucleoplasm	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0030690 all species →	Cellular Component	Noc1p-Noc2p complex	Interproscan
GO:0030691 all species →	Cellular Component	Noc2p-Noc3p complex	Interproscan
GO:0042273 all species →	Biological Process	ribosomal large subunit biogenesis	Interproscan
GO:0042393 all species →	Molecular Function	histone binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14833	NOC2; nucleolar complex protein 2	-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000255-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

46.5Max TPM

13.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.42	21.55
polyp at pH7 6	18	18	15.84	30.69
coral polyp · control treatment	16	16	13.65	23.71
coral polyp · oil and dispersant treatment	16	16	9.69	26.56
coral polyp · oil treatment	16	16	12.14	22.26
coral polyp · dispersant treatment	16	16	9.14	25.43
Polyp	10	10	20.44	46.45

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.55
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.97
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.39
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.95
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.00
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.06
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.04
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.82
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.72
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.67
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.03
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.80
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.27
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.27
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.42
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.09
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.35
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.82
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.35
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.26
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.14
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.25
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.15
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.25
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.33
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.79
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.71
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.14
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.34
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.90
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.85
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.53
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.19
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.99
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.20
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.78
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.88
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.75
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.03
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.80
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.35
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.08
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.79
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.78
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.21
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.74
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.86
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.78
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.57
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.55
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.56
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.83
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.23
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.64
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.58
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.61
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.58
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.68
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.31
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.30
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.94
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	46.45
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	25.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	25.46
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	24.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	21.29
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	20.62
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.11
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.64
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.08

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.