Gene detail

Detailed information of OS493_000282-T1 in Lophelia pertusa

Genomic Location: scaffold_1:3263938...3332355
NR annotation: KAJ7394471.1, hypothetical protein OS493_000282 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000282-T1

ATGACTTCCATTGAAATAGCTAACCGAGGGCTATGGCATGTCATAACTGGACGCTCCTCCCTACAAGAACCTGATCAGATAGCGGAAGAACTGAGACAGAAAAGGGATCGCCTGCTGCAGGGGACTGGGTACTATAAGGAGCCAAGTACCAAGTCAGCTGAAACTCTCCAAAAGTCTCCAAATATTAAACCAAAAAGGAAGGAGTTTGTTGCAAAACTCAGCAAGTTTTTGAATCTTGATGAATGGCAAAGTTTACAGCTTTTCAGCAGCTACCTGGAGAATGACTTTAGAGGCTCCAAACAACAGCTTCTGAATATGTTAAAACATGAAGCTCAGACAGAGGGACTTTTGCTTAAGATCATGGAGTATTACTTTGAAGAACGCCTTCACATCTTACAGTGTGTAAAGTTTTTGTTAAGTTACTGGCAAGATCCCAGGCATCCATTTAGAGAAGAGTTTGCAGATTGTATTGAAGCCATGCAGGAAAACGATGTCATGATTATGAAGATCACAGCTCAGTACAAGAGTTGCTGTTGTGCTGCTGTTCCTGTCCAAGATACTCTAGGATCATCACTGTATCTGAAGACCAAATGCTCCAGATGGGCTCTACAGTATTTGAGAGAACAGATTCTCCTCCTGGAAATCATGTTTCTTTATTACAAAGAGTTTGTCGTCCCAGCCAAGTCCTTGCTACAGTTGGCAAAGCTATTTCAGAGCCAGGGCTTTGGAATAAAGCAGGTCAACAGACATCTGTTTGAAGGACAAGCCGAGCTGCTGCTTCCTCATATCAGTTACCTTCAGGTGTTGATTCTCATAGTTTCATTGGACCTTGAAAGTTTACGAAAGCTGATACAGGAGGACAGTTGTGCAAGACATCATCTTCTTCTGGAGAAGGACACATTGAAGGCACTGGATAATTTATTTTTTAGCTGGGGTGATCAGCCACACCATGGACCTGTCATGTTAGCTTGGGCAGTATTCAGATATGTTACTATGGAAGCCACTCAAGAGCAGTTTGTGAGAAGGATTGGCAGTAAAGCATTGCAGTGCTCTGTGTTTCAATATTTATTGGGAATGTTAAAAAGTGATGAATTCTCTAGAAACAATCCAGTGTCAAATACTTGCAAGAGCCTTATATATGGGCTGATGGTGATTGTCTTAGCGCTTTTTGATGAAGACACATTGGGACAATTACAGCTCTTGGTGTCAGTTTTATCACAAGCTCTCAGTCAGAAAGGTCTATGTGTAGATTTCTGGGATTCAGACTTGAATGCTGGGGCTGGTCTTCTTTTGAATTCTGCAAAAAGTTGGTTTCCACTTCAGTTTCGTCCATTTCTGGAACTTCTTAAATCTCTGGCAGGAGATGAAGATTCTGCAGCAAAGGTTTATGACTTTTTGGATTGTGTGACATCATACACGGAGCTATTAAGAGAGAACCGGCTGGGTGACGTGGACTGTTCTGGTGACAACAAGATATGGAAGATTGTTACTCCAAGACTTCTCTACAAGAATGTGCTTAGTTCAGATTCTAAAGAGCTGACAATGCCTAGTGGTACATTTGGAAAAGTGGCTCCTACTGTTGAAGGACCTGCCATCATACAATGGAGCTATCGCTACTCTTGCTGGAAACTGTTTGCACTGGAAATTGACACATTTCTTGAATCTGTGGGTTCAGGGACAGCTCTGGAATGTCAAAATGTGATTTGTATTGTGGAGTTAGTGAAGGAAATCCTACACAATGACTGGAGCAAGGCAGTTCATCTCAAACCGATCATTGCCCGTCTGTACGTGATTATTCAAAGATGTACTCCATCGCCTAATCCTCCACAAGATTTGATTGCCACCTGTCTATCATGTTTAGCAACCATAGCTCTCAAAGATCCACAGCAGGTGTGGCATCAACTTCAACAGACAAGCTTTCTACCACACTGTGTTTCAGTCAAAATGTCAGAGACAGACAAAACTAAAGTGGAGTTTCTCAGTACAGCACCTGGAAACTTTGGTGCAATTCTGAGCACCAAAGAGAGACCAGTGGGATATTATCCTGTTACCATGGCAACACTAAATTTACTGCTGAGGTTGATCCAAGGAATCAGTATTGCCGAGGACACTGATGGCCAACCAATCAGCTTTCTTGACCTTGCTGCTTGCCTCATGTTTGTGATGAGGGAAGTATTCACTGGTTTCCACAAGTGGAGATTTACTGGGCTGAAAGACAGAGAGGAACTTGGGAAGAGATGCCTTCAGTTGTTCAATGTTGTTCTTGGCCTTCATTTCAAACAGAAGAAAATTGATGAAGCTTGTGAAACAATGGAGGTGGACATGACTGATTTGTCAAGGACTCCAGCAGTGTTGCAGGATACCTTAGTTCTTGGTTTATTGTATTCAGAAGCTGGACAGTCCTTGCTGAACATTCTTGGCACAGGAGTAGACACTGTTGATAAACTTGTGTCTTTAGGAAGCAGTTCCACAGGTGGATATGCATTGGCCCTTGTGGAACTTCTCAAGTTGGCATTCTCTGTGCTTAACAGGCTGCTGGCCAGAAAAGGAAAGGATGATGATATTTCACCTTTGGAAGAAGCGTTAACAACACAAGTTGTTCATCAGCTGAAAGATAAGGGGCACAGTTCTTCTACAAGTTGGGGCAATTGTCAACTTGTGACTGTCATAGCTTCATATGTGCATCATAGACTGGACAGTCAGCTACCAACATTGGCAACACTTTTGCTCAAGAGAATGTGCCTGGTGGCTCCAATGTCAATGCACGCTAGTTTTGGTGCAGAAGCTGTTCCCTTGAGAGATGGTTTTGTGTCAAGACTCAGGGCTCTTACTGAGGATGTCAAACTTAAAGTGGTAATACTGGAGTTTATAGCAACAGCTGTGGAAACTCAACCTGGATTAATTGAGCTCTTTCTTGACTTGTCTTCTAAAGATGACAAGGAATTCATCATTGGGCAGAATAGCTGTCTTCATACAGTTTTAGATATTATTGATCCCGAGAAACAGTCAGGTCACTGCATACATCCTCAGCTAGTGTCTGCAGCATTTTTGTTACTTCACTCCCTGTGGCATGACAGAAGAGATGCTGCTATTACAGCAATACGAAAGAGCCCAAAATTCTGGGAGAATTTAACTCGGCCATTGTTAACTGGGATTCAATCAAATGATGATGAAGATTACAGATATTACATGGAAATATGTTGTTATGCTCTGCAGATTATTGCATTAGAGGCTTACTATGTTTCAAGAGGTCAAGTTGACGAGAGTCTAAAGGCATCCATGAAAACATTCTGTTCAAATCAACGATACCGATACTGGGGTCGGTTCCTCAAGTCTTCAGAACAATCTCAAGCTACAAGTGATTCAGAGGACGAACACTTTGAAGAAGAAAAACTCAAACTACTCAAAGCTTGGAGAACTTTCTTGGTTGTTTGCTCTTCATTTCAGACTGAGATATTTGGTCTAAATGAAACTGGACGAAGACGACAAATCTTGGATGATATTCTGCAAGGATTGAAGTCTCAGGTTTCCAGAAATGCATCGGTAGACAGTATTAACTCTGCTGGTGAATTGTGCAGTGTTTTCTTGATGCTGCTCAAGAGATGGAAGAGCTGTCTTCAAGACCTGAATCCAGTTTTTCAGTGCTTAGTGGATGTCATGGAAATAGCCCACAAGAATGACCCACAGTTGTTTATTCATATCCGTGTGGCCATGTTCTCTGCCATCTCAGTTCTACTTCAACATGCCAGGACTGAACAACTCTCTGATACCTTGGAGAGTAGTTATGCCATGGTTCTCCTGCCACTGGCTTGTGAGCCACTGGAATACTTAAGAGGAAGGTTCACAAACGAAGAGAAACAGCAGGACAGGGTGCTTGAGCTGTCTGTGTTTATCATCGATGAAATTTTGAACATTCTGCTCGCCAACCCTGGTCAGTGGCTCCCTGTACTAAGAGAGCATACACTGTTTGCCTCTCTGGTCCAAGCTTTGGACGTTTGCATCAAGACTCAAGATAAAGTGGAATTCACAGAAGCCATTCTTCACTTGTTCCTGTCGCTGTCAAGAATACCAATGAGTGCTGAGGCATTGGCTATGAACAGTATATCACAACCATTGTGCCTGGGAATAGCGTCACTCTCCAATTCAATAGACAGGCAACAGGCGTCTCAGTCCATGTCTGGTCCCCAGTCCCAAGCTACCTCAAACCACGCGGACCCACTCAACCGACGAAACTGGAACAGAGTATGGCAGCTGTCCCTTGCCGTGATGGGGTCCATGCTGCGCACGCTCAGACATGGGTTTCTTAAGGAAGCGTTGGACTTTGCTGGCGTGCACAGGGAAAGACTTGCAGAGGCCATGGATGGTGTGAGGCGGTCTCAGTCATCAGACGTATTGACTGAAGCGGAGGAAGTGAGTGCTTTCTTGTTGGAACTAGCTCATTTCTTTCACGAGTGGAGGTTCACTCTGCCAGATGTGTTGATTCTACTACAGGCTCGGATTGGCGTTCTTTGCCAAAGTTGCGTGGCACTGCTGACTCACCCAAGATTGCTGGCTCACTTGCTCGAGTTGTCAAAAGGAGCTGGTAGCTCGTCCGTCCATGACAAGAGCCCGCAGTCATCAGACGTGCAACTTTCTTTAAGTGGATCCTTCTCAAGAGAAATGCTGCGAACGTACTCATACGCTGACGATGACTCCTTTAGAAACAGCCCCCTGGTCTCTCAAACCCAGTCCCAGTTGTTGAAGATTCTGTGCAATTCGTTGGCGATGTTGCGACAATTTACACCGGACATTTGTGGAATTCTCATTGATCAGGGTATGGACCTGGATGAGTTCCCTCCCATCCTCTCTCTCGGATTCAGCTCCCCGACTGTGGACAATGAGGAGCCTTTGTCGTTCGGTACTCTTTTGGCCTGCCTTAACATGGCTCTCTCCAATCTTGGCCCTCCTGACCTGAAGTCACCCGTCAAGTCACCAGTCAGGACATTATCAGAGTCATTGCCAAGATCTCTTCTGATGTTTACGATGGAGAATGCATTGATTGTTGCCTTGTCTCAGGCTTGTCGATACTTGAGGGATCCCGGGCTCGACCCGCGGGTCAAGCAGTTTCTAAAGAGAGAGCTTGGTAGTGAACTGGGGAACTTTCTTGGCGGTCTTTTCCGTCATTTCGTTCGACGTGGTCTCCCTCCCTCCCCCGCGAGCGCACAGACGAGTCCGAGCAGTGCGGCGCGGAGAACACCAACTAAGGCTCTGGCATTCACAGAAGCACCCGAACAGAAATTCTTCAAATTGGCGGATACCTTTGTGAAGCAAGTGTTGAGATAG

Transcript

OS493_000282-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5SRE5	Nucleoporin NUP188 OS=Homo sapiens OX=9606 GN=NUP188 PE=1 SV=1
Q6ZQH8	Nucleoporin NUP188 OS=Mus musculus OX=10090 GN=Nup188 PE=1 SV=2
F6WXT2	Nucleoporin NUP188 OS=Xenopus tropicalis OX=8364 GN=nup188 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002935 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10487 all species →	Nup188_N	Nucleoporin Nup188, N-terminal	Repeat	Interproscan
PF21093 all species →	Nup188_N-subdom_III	Nucleoporin Nup188, N-terminal subdomain III	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR044840 all species →	Family	Nucleoporin Nup188	Interproscan
IPR018864 all species →	Domain	Nucleoporin Nup188, N-terminal	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR048883 all species →	Domain	Nucleoporin Nup188, N-terminal subdomain III	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR31431 all species →	NUCLEOPORIN NUP188 HOMOLOG	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006405 all species →	Biological Process	RNA export from nucleus	Interproscan
GO:0006606 all species →	Biological Process	protein import into nucleus	Interproscan
GO:0017056 all species →	Molecular Function	structural constituent of nuclear pore	Interproscan
GO:0044611 all species →	Cellular Component	nuclear pore inner ring	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14311	NUP188; nuclear pore complex protein Nup188	-	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000282-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

29.4Max TPM

10.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.16	16.17
polyp at pH7 6	18	18	11.47	15.24
coral polyp · control treatment	16	16	12.38	29.40
coral polyp · oil and dispersant treatment	16	16	8.66	24.58
coral polyp · oil treatment	16	16	10.99	22.03
coral polyp · dispersant treatment	16	16	8.57	19.97
Polyp	10	10	10.17	14.20

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.17
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.61
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.31
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.96
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.90
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.77
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.74
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.63
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.06
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.83
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.43
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.24
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.65
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.55
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.02
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.80
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.64
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.26
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.96
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.62
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.09
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.49
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.63
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.24
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.69
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.07
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.46
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.09
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.82
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.73
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.58
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.61
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.33
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.17
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.95
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.55
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.88
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.76
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.62
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.61
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.89
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.18
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.68
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.03
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.30
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.77
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.74
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.31
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.39
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.24
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.83
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.66
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.15
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.05
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.14
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.97
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.98
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.74
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.12
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.25
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.62
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.01
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.68
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.99
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.68
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.67
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.17
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.25
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.95
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.30

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.