Gene detail

Detailed information of OS493_000291-T1 in Lophelia pertusa

Genomic Location: scaffold_1:3603271...3622426
NR annotation: KAJ7394480.1, Coatomer subunit beta' [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000291-T1

ATGGTGGAGAGAAGCCATATCTTATATCTGGTGCTGATGACAGGCTGGTCAAAATATGGGATTATCAAAACAAAACTTGTGTGCAAACACTTGAAGGACATGCCCAGAACATCTCGTGTGTTGGTTTTCCCTGAACTGCCTATTATTCTGACTGGTTCAGAGGATGGCACTGTTCGCATTTGGCAAGCCAATACTTACCGACTGGAGAGCACCCTTAATTACGGTCTTGAAAGAGTGTGGAGTATGGCCATGTTCAAGGGGTCTAACAATGTTGCTCTTGGATACGACGAAGGAAGCATTCTTATCAAGCTTGGCAGGGAAGAGCCAGCCATGTCTATGGATTCCAATGGTAAAATTATTTTTGCCAAGCACAGTGAAATTCAGCAGGCTAACCTTAAAAATATGGCTGATTATGATGGTAAAGATGGTGAGCGCTTGCCTCTGGCCATCAAAGACATGGGTCCATGTGAGATGTTTCCACAAACTTTGTGTCATAATCCAAATGGAAGATTTGTTGTGGTTTGTGGTGACGGAGAGTACATCATTTACACAGCTATGGCGCTGAGGAACAAGAGTTTTGGATCAGCTCAGGAATTTGTTTGGTCCTCTGATTCATCTGAATACGCTATAAGGGATGGAAACAAAATCAAGCTCTTTAAGAATTTTAAAGAAAGAAAGTCTTTCAAGCCTGAGTATGGGGTAGAAAATATCTATGGTGGTCAACTTCTTGGAGTGAAGTCTGTTAGTGGGCTGGCTTTCTTTGACTGGGAGAGCACAGATCTTGTACGCAGGATTGAAATTCAGCCACGGAGTATTTATTGGGCTGATAGTGGTGAGCTATGTTCAATAGCAACAGATGAGTCATTCTTCATTCTAAAGTATGTTGCTGAGAATGTCGCTAAAGCACAGGAAACACCAGAGGTCATGACTGAAGATGGCATTGAGGATGCATTTGATGTTTGTGGTGAAATAGAGGATTGCGTCAAGACTGGTATTTGGGTTGGAGACTGTTTTATCTACACTAATGCTGTAAACCGTCTCAATTATTATGTTGGAGGTGAAATTGTCACCATTGCCCATCTGGACAGGACAATGTATATTCTTGGGTACATTCCAAAAGACAACAGACTTTACTTGAGTGATAAGGACATGAATGTTGTGGGTTACTCCCTGTTGCTGTCAGTCTTGGAATACCAGACAGCTGTGATGAGACAAGACTTTGACACTGCTAAACAAGTACTGCCGACCATTCCACGAGAGCAAAGGAACCGTGTAGCTCACTTCTTAGAGAAACAAGGCTTCAAGCAGCAGGCCCTGGCAGTGTCGTGTGATCCAGAACACAGGTTTGACCTGGCTATACAACTGTCAGAGCTGAAGATTGCGTACGAGATTGCGTCCGAGTCAGAGAGTGAACACAAGTGGAAGCAGCTTGCAGAGCTGGCCATCTCTAAGTGTCAATTCCAACTGGCCCAAGAGTGCCTGATTAACGCTCAAGATTTCGGAGGCTTGCTACTTCTCGCCACTTCTGCTGGAGATAGTGACATGATTCTACGTCTCGCGGAGACGTCTGCTAAGAAGGGCAAGAACAACGTTGCCTTTCTGGCTTATTTCCTCCTCGGAAGGTTGGAGGAAGGCATAGAGTTGCTGTGTAGCACGGGTCGGTATCCTGAAGCGGCGTTCATGGCTCGCACCTACTTACCAAGCCAAGTGTCAAAGATCGTCAAATTGTGGAAAGAAGATTTAGGAAAAATCAATAAAAAGGCGGCTGATTCTCTGGCGGATCCGTCAGAATACGAGAACTTGTTTCCTGAATTTCAAGAAGCTTTGCAGGCAGAACAGTTTCTGAAGCGGGAGAGAGTACAAATGAAACCAGCTGCTCAATACAAGCACGTTCCGATTAACACTGATCGTGATGTGTTTGAAGAAATGAAATCAGCCAAGGAGGAGGGAACTCTGGAATCCATTCTGGCGTCGGTAGAAAGCCTCTCATTCAGTGAGCCTTCTGCATCCAAACCAATCGAACCCTCGATACCGTCATTTGCTGCCTCGTCTGCCTCGTCCCACTCCCCACCGCCTCCTGCGCCCGCAGACAGACCGCCAGCGGCCAGGCCCCCAGCAGCGGAAAAAGAACCTGATATCGATAAAAACGCTGCAGTTGAAGATGAGAAGGAAGAAGAAGATGTACTCGATGATGATTTCGACTTCGGGGCACACGACGACGACGACGACGACGACGAAGACCTGAATATCGACGATGACGACCTTCTAAATGACGATGACGATGACTTTCTAAATGATTAA

Transcript

OS493_000291-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O35142	Coatomer subunit beta' OS=Rattus norvegicus OX=10116 GN=Copb2 PE=1 SV=3
O55029	Coatomer subunit beta' OS=Mus musculus OX=10090 GN=Copb2 PE=1 SV=2
P35605	Coatomer subunit beta' OS=Bos taurus OX=9913 GN=COPB2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004164 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04053 all species →	Coatomer_WDAD	Coatomer WD associated region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR016453 all species →	Family	Coatomer beta' subunit (COPB2)	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR050844 all species →	Family	Coatomer complex subunit	Interproscan
IPR006692 all species →	Domain	Coatomer, WD associated region	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19876 all species →	COATOMER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0006888 all species →	Biological Process	endoplasmic reticulum to Golgi vesicle-mediated transport	Interproscan
GO:0006890 all species →	Biological Process	retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	Interproscan
GO:0006891 all species →	Biological Process	intra-Golgi vesicle-mediated transport	Interproscan
GO:0030126 all species →	Cellular Component	COPI vesicle coat	Interproscan
GO:0005198 all species →	Molecular Function	structural molecule activity	Interproscan
GO:0016192 all species →	Biological Process	vesicle-mediated transport	Interproscan
GO:0030117 all species →	Cellular Component	membrane coat	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17302	COPB2, SEC27; coatomer subunit beta'	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000291-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

93.7Max TPM

63.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	51.64	75.78
polyp at pH7 6	18	18	59.75	78.05
coral polyp · control treatment	16	16	72.42	86.71
coral polyp · oil and dispersant treatment	16	16	76.63	91.78
coral polyp · oil treatment	16	16	64.42	89.93
coral polyp · dispersant treatment	16	16	65.27	93.68
Polyp	10	10	53.78	74.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	75.78
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	73.23
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.17
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	57.08
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.61
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.82
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.62
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.22
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.39
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.06
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.23
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.63
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.31
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.39
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.05
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.26
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	76.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.72
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.04
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	63.61
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.08
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.64
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.72
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.10
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.77
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.58
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	86.71
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.86
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.67
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.95
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.31
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	78.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.24
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.25
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.03
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.01
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.07
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	91.78
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.81
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	86.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.90
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.57
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.45
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.59
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.92
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.59
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.21
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	89.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	79.28
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.75
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	67.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.61
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.74
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.84
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.00
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.59
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	93.68
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.43
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.34
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	69.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	68.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.22
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.19
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.53
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.74
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.28
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.98
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.93
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.52
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	74.79
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	72.08
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	69.23
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	56.57
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	52.26
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	48.24
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	47.23
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	47.07
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	45.97
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	24.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.