Gene detail

Detailed information of OS493_000318-T1 in Lophelia pertusa

Genomic Location: scaffold_1:3878337...3918315
NR annotation: KAJ7394504.1, hypothetical protein OS493_000318 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000318-T1

ATGAAGGCAGATGAAGGGGGAGGAAGGCAACTGAAGGAGAATGAAGCGTGTCTTCGTTCACGAGATGGAAGTTGTGTTCATCAACTTCGACAGCCGTTTACTACTATCGGTTGTGAAGGCTGCAGTGATGTTGTCATCCAGTGCTCAAATGTGGAGCGTCAGCATGCTGTTATTGAATATGATGAGTCAGAAAGTTGTTTTGTAGTACAAGACCTCAACTCTGCTCATGGAACGTATGTTAATGAGTGTCGTGTGCAAAATGCTGCAGTGAGACTTGCTCCTGGGGATGTTATCCGATTTGGATATGGAAATACAGGTTTTGAATTTCTTGTTGACACATCCTCTCCAATGCATTACCCTACACTGGCACTTTCAAAACCATGGGAATCGTACAGGCTCCGCGTGTTACCATCACCAGTGGTTACCTCCCAGTCTGGGGGAGTAACCTCCCTTCCTTACATCGCCACTGGCACTGCCATTAGCAGTGAAGGTGTGCCACTGTACCCAAGCTCTCAAGCAATAAGTCTACCTGGTACTGGAGGTTCAGTAACAGAGGTGCGAGGCACTGCTGATTCTAAGACTAATGTGATGCCCCACCCACCCCTGAGGTCACGCCCCACCAGTGCTGGCACCACAAAGACACGCCCCAGCTCTGCTGGTAGAGAGAGGTCTGCTGTTCCCCCTGTTACCAGAGGTGGATGGGTCAATGGTCCAGTGCAGACATCATCAGGGGAACAGACTGCTCAGGAATTGGAGGAGCGTCTATTACGCATGGGTGATGAACTTAGCCGACTGGCCTCGTATGAAGCTGAGTGTCACAGAAAAGATGGAGTCATTGCAGCTCTGAGAGATGAGGTTGTTGATCTTAAGGGAGCTCTCCAACCCAGTGGTGGTTTCAGGGCTGGAGGCGATGACTCAGCATTTTCAAACACGAGTATTATTCTACAGCTTCGTGAACAAGTGTCACAGTTCCAAGTAATTCTACAAGAAAAGGAAGAAAGTGAAAAAACAGCAGCACAGAAGTTAGCCATGTACCAGAATCAACTTCATGCCAAGAACAATGAAGTAGCCATCTTGAAGGACCAACTGCAGGCACAGCCGAAAGCTACAACTTGGGTAAAAACAGACCCGAATGCCTCCACGAACAAGATTGCTTCCTTGCGCACTGAAATAGCTGAGAAAGAGCGAAGAATTGCTAAACTTGCCAATGACAATGAAAAACTGAACAAACAGAAAATGCAGTCTACGACATTGCTGAATGGATTACAGAGAGAGAATTCAGCAAAAGATGCGCTGGTTCACCAGGCCAAGACAGAGATTGAAAAACTCAAGAAAGACCTGCGTGAAAAGGATTCAACAATTTCTACAATGTCAACGAAGTTGGGACGGCAGAAGGCCGCTAAAGATGCAGAAAGAGAAGCACAGAAACTACAGCAGGAGCTTTATGCAAACAAAGGGAAACTTCAGAGTACAGAGAAGCAGTTAAAGGAGAGAATAAAAACTATTGCTGATCTGGAGCACGAGTTAGAGAAAATGAGGGATCATCTTGGTGAAGGACGGCAGAGCGATAAAGCAATTCAACAGGAGTTGGATCACGCTAAAGCACAGTGTCTTGACGCACAAAGAGCTGAGAAACTGCTCAAGGTTGATTTCCATCAGATGGAGAAAAGATTTGATCGCTTCCGGCGGAAGTTGATAGAATACACGTTCAGTGGCGGATTTCCAAGAACATTGGACCATGAGTTGGATGATGATGAACTCCTTGATCACGTGAGACAGATGAGTCAAGAGAAAGTTTCTCTTGTAGAGGAAATCAAGCAGTACGCCAGCTCAGAAAGCGAGAAAGAAGCTAAGGATAAGGATTTCAAGGATTCAACCAACGAACTGCGAAAACATCTGGACGGCATGGCGAAACGGTTGTGGAAATCCGGTCGAACGTGTAGTTCTTTGGAAGAAGAACTGACTTTAGTCGAGGAACTTACAACTCATGATTCTCTTTCTTGGATAAAGGATTTCGTTTGTAAAATGTTGTCTAACGAAACTGCATGGCAACAGAAGGCAGAAGAAGCTCTAAAGAACGCGGCAGATGATTCGGATTCTGAAACCTCTGTCAGCGTTGAAGATATGTGTCGTCAACTAAGAGATCAGAAAGAGGATTGTCGAAAGCTGAAGGGAAAAATTGCAGAAATGGAAGAGACACATCAAGACGTTGTGTTGAAATTACGAGAGGACATGAAGAGAGAGGAAGAAAAACACATATCCAGAGCAGTAGCGGAAGTGAGATCTGAGGAGGAGGAAAAACAACAGGAAATGATACAGGAATTGAAACAAAAGGAACGAGAAAGGATACAAGCGGCAGTGGATGCAGAAAGAAGAATCATGGAATCACAACATGGCAGCGTTACACAGTTACAACAGCTACTAAACGATCGACAGAAAGAGTTAGAGAATCATCGAGTTGCCTTAGCAACAGCCAAGTCTCAGTATGAACAAGCTAAAGATGGATTACAGAGAGCGAAAGAAACCGAGAATCATTTACGAAACCAGCTTCACGAGCAAACCGCTGTGTACAAAGAACAGCTGACTCGTGTTGATCGCGAGAAGGACGAATTGAGAAATTACAAAGAAGAAGAAGTTGCTTCTTTCAAGGAGCAGACCCGACAACACGCTGTCACAATTGTAGCTATGGAAGAAAGACTCTTACGACTGACCAGACAAAATCGACAACTGGAGCAGGACGCAATGTATTCCAAACAAATGACTGGCAAGAGCCGACCATCTTCTCCGCGTAAAGAAACGTCTCGACCCTCCTCTCCTAAGAAAGAACTTGTGACGTCATCTAGACCTCAGTCCCCAAGAAAAGATCCAAAACCACAGACGAGATCAGTCGAGACGGAGACTGTGCCCCAGACAAGCGTGGAAGCCACTTTACAGTCAGATATCTACAAACTAGAGCAACTTGTTTTGTTGCTAAGGCGCGAAGCAGCTCAAGCAAAGAAGGAAGCTGAGAGTCAGGGTGATGTAGTACAGGCCTTGAGGCGGGATCTGGCAGGAGCCGCAGCGCGCATGTCTGACATGACGGGCGAGTTAAGTGATAAACAAAAACAAAAACTCGAGCAGTACGAGGAACGAATCGGAGAGCAGGATGGTGAACTGGATGTACAGAGAAAACAACTGGTGCAGTTGTCGGCTTTGGTCGATGAACAACAAAAAGAGATTAATTCAAGAGAAGACAAACTCACTGAACAACAGAAGGCGTTACTAAAGCAAAAACGAGACACGGCCAAGAAAGGAACTGAACTAGTTGAGTACAAAGAACAACTGGCAACACAAATTGAAGAGCAAGAGGAGAAGTTAAATATGATCGAGAGAGACAGTCTCAAGACAAGTGAATTGCACTCGCAAGGACTGCGGTGCAGAGGAGAGCGACATGATCTGATTATAGCGAGACAAAAGGAAGCTTTAGCGGACTTTAGAGATCGAACAAAAACACTGGAACAACTCAAACCACCTCTTCAAAACCATGAACAAGCTCTACAACAGATCGTTGCTCTTAAGAAAGAAGTCAGTGAACAAAGAGCGAAGTTAGCTTCACAAGAGGAAGACTACCACAAGAGCGAGGGTGAAATGCATGTTGAGCTGAGATTGAGACGCGAGCAAGCTTCCTCCAGCTTGGCTGAGACAGATGGAGAGAAAGGTGCTCATCGGCACACAAAAGAAGCATTGGACTTGAGTGAAAAAACGTACCTCAAGCTGGCTCGTACACTCGGAGCATTGCTGGAAATAGACCCGGTTCCAGGCTCGCGCTCGATGGCGCACCTTCCTGTAGAGGAGCGAGAAAGACTGGAACTAGATAGGACGAAGACTGTGGAACTGATGGTTTCTAAAGTGCAACGGATGTACGAGCGAATGGAGAGGAAAGTTCAGCTGCTGGGGTCATACGAAGATGACTTAGTACATCTCAGGAATAGTGAGACCACGGCAGGACAGAAAACGGCGGAGGCGACAGGCCTGAAGATGGATGTCCGAAATCGCCAAGAAGAAATTTCTTATCTGAGAGGGTCAATGACCAGATTACGAGATGATTTAGATCAACAACGAAGGCTGAATGTCTGTTTAAAGGAAAGAAAGAAATTCGCCATTGACATGGAGGAACGAGATACGAAGAAATCAACACACAGCTGTTACATGGACGAACATACGCGATACAAGGAAGAACTGAAAAAGAAAAAGGCGGCAGAGAAACTCAAAAGGAAAAACTACGAAATAGAATCACTCAAAAAGGAATTGATGTCCGCTGACCGGGAACTTAATGAGACTGCTGTCAAGTTGCAGCTTCTTGAGTCCAGCAGAAATTTAACAAGTGCTCGAAGTGCTCACAGTGAGGACAGCGCTCTGTTAGATTATGACGAATAA

Transcript

OS493_000318-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B1AJZ9	Forkhead-associated domain-containing protein 1 OS=Homo sapiens OX=9606 GN=FHAD1 PE=1 SV=2
A6PWD2	Forkhead-associated domain-containing protein 1 OS=Mus musculus OX=10090 GN=Fhad1 PE=1 SV=1
Q9Y4F5	Centrosomal protein of 170 kDa protein B OS=Homo sapiens OX=9606 GN=CEP170B PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001085 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00498 all species →	FHA	FHA domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000253 all species →	Domain	Forkhead-associated (FHA) domain	Interproscan
IPR008984 all species →	Homologous_superfamily	SMAD/FHA domain superfamily	Interproscan
IPR052642 all species →	Family	Coiled-coil and Forkhead-associated domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18853 all species →	FORKHEAD-ASSOCIATED DOMAIN-CONTAINING PROTEIN 1-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_000318-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000318-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

41.2Max TPM

11.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.09	15.90
polyp at pH7 6	18	18	9.49	15.86
coral polyp · control treatment	16	16	14.78	41.19
coral polyp · oil and dispersant treatment	16	16	11.49	18.86
coral polyp · oil treatment	16	16	13.59	20.08
coral polyp · dispersant treatment	16	16	11.29	17.86
Polyp	10	10	8.91	13.47

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.90
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.91
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.14
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.69
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.33
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.72
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.68
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.79
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.19
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.82
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.80
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.40
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.76
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.62
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.27
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.26
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.99
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.70
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.45
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.85
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.74
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.66
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.91
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.34
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.13
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.99
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.85
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.86
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.57
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.50
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.08
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.15
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.46
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.00
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.57
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.69
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.60
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.82
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.08
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.69
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.14
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.30
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.61
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.22
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.10
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.34
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.86
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.25
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.62
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.10
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.22
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.95
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.96
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.28
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.66
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.47
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.07
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	10.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.89
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.75
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.77

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.