Gene detail

Detailed information of OS493_000462-T1 in Lophelia pertusa

Genomic Location: scaffold_1:5578610...5613839
NR annotation: KAJ7394642.1, Ubiquitin conjugation factor E4 B [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000462-T1

ATGAGCGAATTATCGCCTGATGAGGTTAGGCGCCGTCGCCTTGCCAGGTTGAATCAAGGTGCCGTGCCAACATCCCTTGCTCCATCTGACAGTCAAGCCATTCCTGTTAGGACAAGCCTCAAACCCTTGGCAGAAGATTCAACAGTTACTATTACTACTCAAGACAGTGGTTATGGCTCTCTGCCGCAATCGTTTGAGTTTGATGATCACTCACAAGACACTGGGGATAAGTGTGGCAAGCGGACTTCCCCAACCTGTTCTTCTTCTCCTTCAGAAAGTTTTAAATCCAAGAGAACAAGAGATGGATTTGATAAAGATGACTCCTCCCATGTAAAGTTGAATGTGACAGATGAGCAAATTGTGAAAAGTATTTCCAACATATTTCAAGTTTCTTTGAAGACCTCCGAAGTATCTTCAGACACAGTTTACTTACACTCATTAGCAGGGGATCTGTATGAATTGGATCTCAGTTCAGGGACTATTTGCGACTTTATAAGTCAAGTGATTACGGAGAGACTAACCCAGTCACATGCTCATAAAGATGGAGTGAGTTTCAGTCCAACCCTGACCATTGCTGAAGAGACATCCCAAATGGCTATTGATGATAACTCAACAGACTGTAGGTCATCTGAATGTAGCAGTTTATCAACAGAGGGCAAAACGGATTGTTTAGCATTAAACTGCTGCAGTGGTGGTGTGTTCGGCATGGAGTCACCTATCATCTATCAGACTAAGCAGCTCAAGTATTTGGTTCATAGTTATAATCGCTCCTTGAATGAAGAAAAAAATCATCCAAAGCGATCCACAGAGGAAAGATGGATATCCACCATGTCTCAGGCTCGCCGTCAGTGTGTATCATTTTCATTGCTTATTCTTCAAGGATGTTTCACTCAGGAAAGGTCTGTCCTTCAGAAGTCGCCCCTGGTACACCTTCTTATCAGTGAAGAATGTAACATTCCTTGGTTATTTCTTGTGGATCTTGTCACAACAGCAGCAAATGACTCAGATTTACTTAAACAGGTTTTCAAGCCAGTGCTTTTGAGTTTGAATCAAGAAATGCAAAAGTGTAATCTGGCAATTGATGGATGTAAAGCACCTTTACTAGCACTTTCAAAGTTGTGTGACATCCGCCTAGGAACAACCTCTGTTCGACCTATCTGTAACTTGATGGTGACTTTGTCTGATCTGTGGATTCCATCTCCATTATCAAAAGCTGAGGGAAAGGAGATTGAGAAACTATCGTTCCTTGGACCATTTCTTAGTCTGTCTGTGTTTTCTGAAGATTGTCCACAGATCATTGATCGTTATTTTTCGGAGTCCTCAGAAAATGTTAAGCTGGTAAATGTCACTTTGAGAAGTGCTCTTCATCTTGTGAGGACAGAGGTATTCAAGATAATTCACAGTATGCTAGTGTCTATGGAGAGTCGTGATGCTTGTCTGAAGTTCATGGCTACAGTTTTACAAAGAAATCACCGCAAAGCACAACTACAGGTTGATGATAGACAAGTTGCATCTGATGGATTTATGTTAAACTTCATGACTGTGTTACAACAACTATGTGAAAAGGTTAAAATTGAGAAGGTGGACAATTTGTATTTCCATCATCCCAAATCAAGAATAGATATATCTCAAGAGTCCAGGCTGAAACTCACTTCACAAGAAGTTACAGAATGGAAACAGGAATTAGATAGTAAAAATGCTTGGTTGGAGCCCAAATTTCCCACGGAGTGTTTCTTCATGGCCATACAACTACATCATGTAGCACTTTTACCAGCTTGTAGGAGACATTCACGCAGACAAAGAGCTCATCGTGATTTAACTCGCATGATTGAACATTTAGAATCCCATGAGAGTGAGTGGATGGAAACGCCAATGGCTTCTAGAAACAAAGGCTTGTTAAAGAAATGGAGAGAAACAGATCAAGGTAGGAAACTTGACAATGGTAAGGCTTGTTCAGATGTTGGATTACTTGATGAAGAACTGCTACGTGGCTGCTTAAAGTTCTATGGGTTCTTGGCTACGTGGATATTGAAGCTTGTGGATCCCAGCAAAAAGGGGCTTAGTATCCCTCTGCCAGAAAAGATTGCCATGGAGCTTGCATCTCTTCCTGACTACCTTGTCAGTGATGTGGCTGATTTCTTGCTCTTTGTCAATATGCATGCATACCCAGTACTGGAGGATCCTGTTATGAATGACATTGTTACCTTCCTAGTTGTCTTTGTTTGTTCACCAAACTACATCTCAAATCCATATCTTGTGGCAAAAATTGTCGAGGTACTGTTTGTAATGAATCCCAACATTCAACCAGTAGCCTCAAAGATTCATGAGATGATACTCTCCCATCCGTTGGCAATGGACAATCTGGCTCCAGCTCTCATGAATTTTTATACAGATGTAGAAACAACCGGTAGCTCAAATGAGTTTTATGACAAGTTCAGTATACGGTATCACATCTCTATTATAATGAAAAGTTTATGGGAAGACTTGAGCCACAGGCATGCCATCATGAAGCAAAGCAGAACGGCCCAGTTTGTTCGATTTGTGAACATGTTGATAAATGACACAACATTCCTGCTGGATGAATCTCTGGATTCACTTAAGAGTATCAATGAAACACAGCAGATGATGGCTAATGCAGCAGAGTGGGAGGCATTACCAAGAGACATGCGTACATCCCGTCTGAGACAACTAGCCACTGATGAACGGCAGTGCCGTTCATATCTGACTCTTGCTTCAGAGACTTTAGACATGATGCTGTACCTGACTAAACATGTACAGGGACCTTTCCTTAGGCCTGAATTGATTGATCGCATAGCTGCTATGCTGAATTTTAACCTGCAGCAACTTTGTGGACCAAAGTGCAGGAACTTGAAGGTTAAAACTCCAGAAAAATACGGATTTGAACCAAAGACTCTCCTAGATAGACTCACACAGATTTATGTCAATCTTGACTCGGAAGAATTTGCACAGGCCGTTGCTGGAGACCAGCGATCATACAAAAAAGAATTGTTTGACGATGCCGCAAAACATCTTCATAAAACCTTGCTCAAGACAGAGGCGGAGATTTATCTTTTTAAAGAATTTGCGGCCAAAGTGGAAAGGAAAGCTGCAGAAAATGCTGCTCTAGAGGAGGATTACGATGACGCGCCTGACGAATTTAAAGACCCTCTTATGATGACGCTTATGCATGAGCCTGTGATCCTACCAACCAGTGGTAAAATTATGGATCGAGCAGTCATCACGCGCCATTTGTTAAACTCGGACACAGATCCTTTCAATAGACAACCACTTACAACGGATATGCTAAAGCCTGCTTCTGAACTCTTGACACAGATAGAGGAGTGGCTGGAAGCACAGAGATCAAAGAAGAAATCACAATGA

Transcript

OS493_000462-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9ES00	Ubiquitin conjugation factor E4 B OS=Mus musculus OX=10090 GN=Ube4b PE=1 SV=3
O95155	Ubiquitin conjugation factor E4 B OS=Homo sapiens OX=9606 GN=UBE4B PE=1 SV=1
Q9HE05	Ubiquitin conjugation factor E4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=ufd2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003726 (this species only)
Ubiquitin family	E3\|E3 activity RING\|U-box · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10408 all species →	Ufd2P_core	Ubiquitin elongating factor core	Family	Interproscan
PF04564 all species →	U-box	U-box domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045132 all species →	Family	Ubiquitin conjugation factor E4	Interproscan
IPR003613 all species →	Domain	U-box domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR019474 all species →	Domain	Ubiquitin conjugation factor E4, core	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13931 all species →	UBIQUITINATION FACTOR E4	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000151 all species →	Cellular Component	ubiquitin ligase complex	Interproscan
GO:0000209 all species →	Biological Process	protein polyubiquitination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0030433 all species →	Biological Process	obsolete ubiquitin-dependent ERAD pathway	Interproscan
GO:0034450 all species →	Molecular Function	ubiquitin-ubiquitin ligase activity	Interproscan
GO:0036503 all species →	Biological Process	ERAD pathway	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10597	UBE4B, UFD2; ubiquitin conjugation factor E4 B	EC:2.3.2.27	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000462-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

111.9Max TPM

36.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	22.14	31.90
polyp at pH7 6	18	18	23.29	30.40
coral polyp · control treatment	16	16	42.08	74.16
coral polyp · oil and dispersant treatment	16	16	60.67	111.88
coral polyp · oil treatment	16	16	39.41	65.28
coral polyp · dispersant treatment	16	16	40.99	76.04
Polyp	10	10	26.81	35.39

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.90
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.85
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.70
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.08
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.05
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.63
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.44
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.95
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.56
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.72
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.95
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.46
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.95
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.19
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.96
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.22
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.38
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.40
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.35
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.77
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.57
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.21
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.47
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.84
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.16
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.48
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.21
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.18
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.96
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.29
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.95
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.63
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.76
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.24
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.51
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.64
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.32
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.25
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.86
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.14
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.26
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	111.88
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.14
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.33
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	69.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.32
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	65.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.19
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	51.08
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.31
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.90
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.16
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.28
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.48
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.16
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.12
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.40
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.93
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.01
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.93
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.61
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.04
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.04
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.80
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.73
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.68
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.73
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.29
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.23
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.27
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.72
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.93
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.40
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	35.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	34.05
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	32.47
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	31.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	30.08
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	26.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.16
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	22.10
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	17.56
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.73

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.