Gene detail

Detailed information of OS493_000498-T1 in Lophelia pertusa

Genomic Location: scaffold_1:6336728...6455847
NR annotation: KAJ7394677.1, 5'-3' exoribonuclease 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000498-T1

ATGGGAGTTCCAAAGTTTTATCGATGGATTAGTGAGCGATATCCATGTTTGAGTCAAGTTATTCAAGAACACCAGATTCCTGATTTTGATAATTTGTACCTGGACATGAATGGAATCATTCATCCATGTTCTCATCCAAATGACGATGATCCTCACTTCAGGAAAACCGAAGAAGACATTTTTGCTGATATATTTCAATACATAGAAGTGCTGTTTCGGATCATTAAACCCAAGAAAGTGTTCTTCATGGCTGTTGATGGTGTGGCTCCTCGGGCAAAAATGAATCAACAAAGAGGAAGACGTTTCCGGTCTGCCAAAGAGGCAGAAGACAACATTCGCAAAGCTTTAGAAAAGGGCCAAGTTCTACCCGAAGAAGAGAGATTTGATTCAAATTGCATTACCCCTGGTACTCCTTTCATGGTGAGACTTCATGAGCAGTTAAAGTTTTTTGTCAACTATAAGATTTCTACTGATCCTGCTTGGCAAGGATTAAGAATATATTTATCTGGACATGAGACACCTGGTGAGGGTGAGCATAAGATTATGGAGTTTATCAGATCAGAGAAGGTGTGTCCTGACTACGATCCCAACACAAGGCACTGTTTATATGGCTTAGATGCTGACCTGTTGATGCTTGGGCTTTCATCGCATGAGCCTCACTTTTCTCTGCTTAGAGAAGAAGTGAGGTTTGGAAAAGCAGCAAAGAGAATTACAAAGGCTGAAAAGACCACTTTTCATCTTCTTCACTTATCTCTGTTCAGAGAGTACCTGGATTGGGAATTCAGTGAACTTAAGGATAAACTACCATTTCCTTATGATCTTGAGAGAATCATAGATGACTGGATTCTTATGGGATTTCTTGTTGGAAATGATTTTATCCCACACTTGCCAAATCTACATATTAACCATGATGCTTTGCCATACCTGTACAGAGTTTATATCGATGTTATGCCTTCTTTGGATGGGTTTCTTCATGACGGTGGAAAGCTTATATTATCCAGATTTGAGAAGTATCTTGTTGGTTTGTCTAAGTTTGACAGAGAACAATTTGAAGAGAAGTTTGTTGACATGAAATGGTTTGAAAGTAAGAAGGGTTTTACATTTGGAAATGACCCTGTGCAGAAAGATGATTCATTGCTGACCTTAGACAACAGTTTTGCAGCTTTAGAGTTAATGCCTGGAGATTCTATGCCTACAAAAGCAAAACAGCCAAAAAGGAAAGTCAATCCAGAACTTGAAAAGCTTGCAGCAAAATTTGACGAGGACCTTAGTGATGATGATGAAGACATCTTTGAGACTGAGTTTGCAATGCTAAAGAGAGACTACTACATGCAAAAGTTGGGATATGAAGAAATAAACAGAGATGTAATGGCTGAGCAAACATTCCAGTATGTGACAGGAATCCAGTGGATTCTCTCGTACTATTTCAGTGGAGTACCATCGTGGAGTTGGTTTTATCCTTTCCATTATGCTCCTTACATGTCAGACATAAGGAACTTCAGTGAACTAGATATCAAGTTTGAGTTGGGAACTCCTTTCGTTCCATTTGAACAACTGCTGGCCGTTTTGCCAGCTGCTAGTAGACAGCTGCTTCCAAAACCTTTCCAGAACTTGATGATAATGGAGCAGTCTGATATTATTGAATATTATCCTGTGAATTTCAAGACTGATTTAAATGGCAAACAACAAGAATGGGAAGCTGTGGTCCTGATTCCATTTATTGACGAGCGGAGGCTGCTTGATGCAATGTCACCTCTGTATTCAAGGTTAACTGAAGAGGAAATTACCCGTAACAAGCATGGTCCTTGCCTACTTTACACTTATGACCCAAGCCTCAGTTTCTTTTGTCCTTCATCACTGCCTGGAAAGTTTCCTGATATTTGCTGTTGTCATGCCAGGTGTGAAGTGCTCAATAAAGATGTTTTTCTTGTTGATGTTCAGCTCATGAGTCGAGGTCTCTGTGAGGGAGTTAAACTTGATGTGTACTACCCTGGATTCCCCACTTTGCATCACATTTCGCACAAGGCAGAGTTCAAGAAAGCAAGTGTAAAGGTTTTTCAGATGCACAGCAAGGGTAAAAGTTTGATTCTTCAAATCACTAAGCCACAAGGAGAGGTGTCATCATTAGAAATATCAGAGGAATTGCTGGGAGAAACTTGTTATGTTGGCTGGCCTCATATGGTTGAAGCTTTGGTAATGGGTGTTTGTGATGGCAGTAAAAGATATTTTCTAGAAAACAAGAATTCACACAATTCTTCAAAGGAAATAGCACACCAGGTGTTGACAGAGCTGGAAATTAAAAGCTGGAAACATCAAGTCAAGTCCATGGCAGAAAATCAGTTAGAGAGAAGAGGAATAGAACTTGGAGAAACAAATGTTTTGATTGAAGCATGCCCCATCAGAGGAAAGAGATATGTATGTGGAGCAAAAGGTCTGGTTACTATGGAAAAGGAATGGTCACCTATGCCAATCTCTTATCCTCACCAGTTGACTGTTAAGGACATTCACGTCCACGAGTCACATGAAGATGATAAGATTCACACAATTGAAGAACTTTTCCCTATTGGAAGTCAATGCTTCATGTTAGCATCACCATATTATGGCGCTTCAGGTGAAGTGATAGAGATTGATGTGAAGCAGTCACGAGTCAGAGTTCAGCTTCATGTGCCAGTTGAACCTGACATATCATCTGTCATTGATCGACATCAGGCTTTGACACTTCATTACCTGCCAGCATATGTTGTAGCCAAAAAGCTTGGTATCACTCCAAACTTGCTATCAAGAATAACTGGCAGTTTCCTGATTTCTCACGGATCCAGTACAGATGCATCTGGTGGAGGTAAAAAGCTTGACATTGGACTGAACATGAAATTCAGTAAACAGAACAAAGAGGTTCTTGGATTTGCCAGGAGAACAGAAGAGGGTGGATGGACTTTCTCTCCTACTGCTCGGAAGACAATTGCCGAGTATTTAAAGAAGTTTCCTCAGCTTTTTGAATCTCTGGCTAGGATGCCCTCAAATGATCGCTGCTTTGCAAAGGATTTGGATACAGATGACAATGGGGGCAAACCTTTATCAGAGGTTCAAGATTGGCTGAAAACAATACCTACACTCAATTTAGAGCCAGTCAAATGCGGAAGCATCAGCTTAGATGAGCCAGTTGTTGAAGCTGTAGAGGAGGCAGTGCTACAAACTAAGACATTGAACCAGAAGCCCAAGACAGTGAAAGTACGTGTACGGCCTCACCTCCTGTTTACGCCGTCTGAACATCTAGGAGCCGTTCTTCCTGACAATGATGCATCTTTTGAGTTATTTGACCGAGTTGTTAATGTCAAACTGAATGCAGCCGTTCCATTCGGATTAAGAGGAACTATAATTGGCATTCATCAGGGTGATGACTCATCTGATGTCCTGTATGAAGTTGTCTTTGATGAACCATTCCTCGGTGGTTTGCCGCTAAGGTGTTCATCTAACAAGGTGTACTTAATGACAGCTGCATCACTTATCAACGTCAGTTATGGTGATCGATGTGAAGCTAAGAAGGTTGAAGAAAAGTCAGCAGGCAGAGGTCAACAGCCAGGAGGCAGTGCTGCATTCAGCCCCAGCCTGGGCGCTTCACCTGAACTGGGCAAGAAAAACAAAAACATGAAATATAAGTCAGCAGATGTCAGTCTAGATTCTCCAGGACCATCTGGATTTGGTCGTGGTATGTCTCCCAACACGCCGTATGGTGGTGGGTTTGGTCCATCGAACGGCTTTAACACTCGTGGTAGCCCTTTACAATTGAAGAGCTCGCCAAACTCAGCGAACAGTAAAACAAAGCAGAGAACACCAGTGATTCAGGCCAGAGGATCTCCACAAGCTCAAATCAATACTTACAGAACAGTAGAAGGCACCGTTGATGATAGGATGTCCACACCTCCAAGATTTCAAAAGATTTCTCGTGTTCCAACTGATAAACCCAATAATGGTCCAAGTGAATTTGCTGACATGTGGAAAGAACTGAAACTCAAAGAAAACAGTGCTTCTGGCAGCAGTACTGATGAACACAGGGAGCCTGATGACAGAGGCAAGGAAACAAGAGAAAGCGACACATTGATCAAGGATGGAACACAGGCTCTCCGTGAACTGCTTCAGATTGGTCAGCCACACAAAGACGTGATGGAAAAACCACAAGCTAAACCCGAGCCAGCCCTCCGTGGCAAACAGCTCTCACTGGATGAACTCTTTTGCAGTCAAAGTTCAGCCCAAGCCACTGTTCAACAGATTCCACAGGTACCCTTGCCGTACCCCTCTGGGAGCCTTCCATCGTTGGCCTTATTGACTTGGTGTCGCTCTGTTGGTCTGCCGCCTCCTTACTACCACCACACCCCAGGACCTCAGGGAGTGATTGCTATAGTAGAGTTAGCCAATGGATTTAAATTTCCTGGCAGTGCCTGTCGTGATCAAGGTGAAGCTGTAGAGAGTGCTGCATCTGTTGCGGTGTTTCAATTGCCACGAATCATGCCGAACATCCCAAGTCCTCAACACATAGCCATGCAGCAGCAGTTTTCCCCAGGCTTCTTTTCGTCTCTACCTCACCCAGTCATCCCGCCAGCCTTTGCGGGGTTGGCTTCATTGTCCTCTCCAAGACAAATTATTCATCAACAGTTACCCCAGTCACAAGCTAGCATAAAGAATCCAAGAACTACAGGTGCACCATCAAGGGAGACTCTCGCTCAGCAAGGAGTGAATCCAGTTCTGAACATTTCAGCGGTACCTTTCATTCCACTACAGGTTTCTAGGAGAAGTTCGTCACATCAGCAATCTCCAGCGAAACCACAAGAGACGGCGGTAATGGAAAGTCCGGTCAGCGGTCCCTCTATTGAAGATACTAAAGTAGATGAAATTCAGCAAGAAGAGCAGATAATTAACTCTGTACAACAAACAACTGACGAGCACGAAGATGTTTCAAATACCCTGCTATCAGGGTTATCAGCCAACAACTCTTGTGCTCCGTCAGATAGTTCTTTGCCAGTACAGAGAACCGAGAAAGCTGGCGCTTCTTTTAAAAGAACACCCAATTCTTCCAAAAGACTGCTGGCTCCAAGTTTCTTTTCAAAGAAAAGCTAG

Transcript

OS493_000498-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8IZH2	5'-3' exoribonuclease 1 OS=Homo sapiens OX=9606 GN=XRN1 PE=1 SV=1
P97789	5'-3' exoribonuclease 1 OS=Mus musculus OX=10090 GN=Xrn1 PE=1 SV=1
P40383	5'-3' exoribonuclease 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=exo2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001148 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17846 all species →	XRN_M	Xrn1 helical domain	Domain	Interproscan
PF18332 all species →	XRN1_D1	Exoribonuclease Xrn1 D1 domain	Domain	Interproscan
PF03159 all species →	XRN_N	XRN 5'-3' exonuclease N-terminus	Family	Interproscan
PF18129 all species →	SH3_12	Xrn1 SH3-like domain	Domain	Interproscan
PF18334 all species →	XRN1_D2_D3	Exoribonuclease Xrn1 D2/D3 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR016494 all species →	Family	5'-3' exoribonuclease 1	Interproscan
IPR047007 all species →	Homologous_superfamily	5'-3' exoribonuclease 1, D1 domain superfamily	Interproscan
IPR047008 all species →	Homologous_superfamily	5'-3' exoribonuclease 1, SH3-like domain superfamily	Interproscan
IPR041412 all species →	Domain	Xrn1, helical domain	Interproscan
IPR040992 all species →	Domain	5'-3' exoribonuclease 1, D1 domain	Interproscan
IPR004859 all species →	Domain	Xrn1, N-terminal	Interproscan
IPR041385 all species →	Domain	5'-3' exoribonuclease 1, SH3-like domain	Interproscan
IPR027073 all species →	Family	5'-3' exoribonuclease	Interproscan
IPR041106 all species →	Domain	Exoribonuclease Xrn1, D2/D3 domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12341 all species →	5'->3' EXORIBONUCLEASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000956 all species →	Biological Process	nuclear-transcribed mRNA catabolic process	Interproscan
GO:0008409 all species →	Molecular Function	5'-3' exonuclease activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0004527 all species →	Molecular Function	exonuclease activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12618	XRN1, SEP1, KEM1; 5'-3' exoribonuclease 1	EC:3.1.13.-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000498-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

52.8Max TPM

26.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	26.88	37.51
polyp at pH7 6	18	18	25.97	37.12
coral polyp · control treatment	16	16	33.51	52.78
coral polyp · oil and dispersant treatment	16	16	27.73	41.21
coral polyp · oil treatment	16	16	28.65	37.94
coral polyp · dispersant treatment	16	16	23.32	35.79
Polyp	10	10	16.78	26.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.51
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.98
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.08
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.74
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.42
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.05
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.95
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.27
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.97
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.56
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.98
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.69
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.47
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.16
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.12
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.23
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.55
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.57
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.72
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.11
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.69
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.01
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.98
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.86
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.02
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.17
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.31
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.87
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.95
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.11
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.75
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.76
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.12
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.97
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.83
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.21
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.56
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.38
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.94
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.08
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.09
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.94
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.94
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.42
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.80
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.48
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.40
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.91
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.85
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.11
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.10
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.67
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.22
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.75
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.90
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.23
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.70
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.79
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.34
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.58
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.27
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.27
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.16
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.29
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.26
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.74
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	26.74
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	24.77
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	22.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	22.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	21.88
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	10.62
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.07
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.02
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.96

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.