Gene detail

Detailed information of OS493_000613-T1 in Lophelia pertusa

Genomic Location: scaffold_1:8655120...8669217
NR annotation: KAJ7394779.1, hypothetical protein OS493_000613 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000613-T1

ATGGAGGAAGCAAAGGTGGACATAGGCGTTATTGAACACTTTAAATCGGGCATTTCACTGGATAAGAAAAAACGAAGAAAGATTCTTGAACTGTTCAAGTATTTAGCGGGAGGTGAGAGTCCTATAGAAGCGGTGGAACTGACTGTTCGCCGAGATCGGAATCTTCGCGAAGCACAGCTGAAGTCGGTGTACGAGATGGTCAAACTAGTCGAAAATCCACCGACCTTGAAAACTGGAAGCCCCGAGAAGAAATTGGTTCTTAGTGTGCTGATTAGCTCAAATCTCCTTAACTTCATAGTCAGACTTTTATGGATTCGTATTCCTGACGAATGCACAGGGAACAATGACCAGCCATGGAATGCGGTATATTTTAACAGTTTATTTGTCCTGAAACACATTTTGACCCTTCCTCGTTATACTCAAACAAATCGTACACAAATCATGGAAAACAATACTGTGGAAGCACTGTTGGACTTCTGCGATGCCGACCTTGATCTTTTGGGTTGCTACCCAGCAGTATGTGCACTAAAAACTTTATGTTGCTTGGAACGTGGGGCTTGTGACAGAATTGTCCTTTTAAATGCACTTCCAAAGATTGGAAACCTGATTTCAAAAGACAATTGTCAAAAAATGATTGTCAAAGCATACAGGCGTGGAATTAGGCCTTACGAAGGACGTGTCTTAGATGATCGTTTTGATCAGTCGGAGGAAAACTTCAAAGGTTTCCGAGTGCCGTCTATTGCTGATAGCGCATTAAATGTTTTACGGACTTGGAGTTGGAAAATGCAGATGGAAGCTTGTGTAATTATTGTTCAGATTGCAGAGCAGAATGACCAATACAGAAAACTGGTTTTTAAAGATAAAATAATATCAAAGGCCCTGTTAAAGCGGTTCAAAACACCAGCAGTAACTGGAAATGACCTCAATATGATGGCAATGAGCATGAAGATCGTCGGCACGTTGTGCCTGAGTGAAGAGCTAAGCTGGCAAATGATTGACAAGAATGGTATTGTGGCATGCTTGGAAGATGGAGTATACTTGCCTAATAATGGACCACTGAATTCATATCTGGAGGTGATATTGCAACTTTCTACTCACAGTGGTCGATGCAGAAACAAAATACTGGAAAGTGAGGAAATTGTTCAGACACTTGCAAGATTAATGTTTTCTTATCACAAAGAGATTCAAGGCCCCACCTTGCGCATTATCGCAAACCTTGCAGAGTCGGATGATATGGCTACGAACTTAATAAAATGCGGCATAACTCCAAAAAGTATCACGTTGGTCATCAACTATTATCAGCCTTCTGCAGTGAACCATGCTCGGAAGATAGAAAAGGTCCTGCGGAGAAATTGTGAAAAAGAATGGAAACAAGAAGAGATGACATTTGCAAAAGAGCGTGTTGATTTCTTTGCACGTCTAGATGAAGAACGTTCCCAGACTCTAAAGGACAAAGGCAACACGAAATTCAAGTTAGGCTTGTTTAACGATGCAGCACGGCTTTACACAGAAGCGTTAAACTGTGTCCCTTACAGTTTGGAGGCTGGCAAGGCGGGAAAAGATGGGACTCGATGGTGGGTTGTGCCAGCTGTGTTGTATAGTAACCGTGCTCAGTGTCACTTGAACAACTCTGACTGGGATAGCGCCCTTAGTGACTGTAATGAAGCCATGGCAAGATGCCTTGAAGACAACGAAGAATCCGACAAAATACTTGTAAAAACAATGTTCCGTCGCTCCAGGGCCTTCATGGAGTTAGGACATCACTTCAGAGCGCTCAATGACATCTCGTTCTGTCTGAGACACACTACGCCTGGTGGTACAAGCAATTCTCAGGCCCCTTACTGGGAGATTATGGTGAGATACCGTAATACATGTGGAACGGAACCCATCCGTCGCTGTGGCAACTGTGTTGGCGGGGAAGGAGAGAAGTTGAAAAGGTGCGGTAACTGTGACGAGGTATACTGCAGCCGTGAGTGTCAAGTCTTGGCCTGGGAACTAGGTCATAAGACCTTTTGTAGGAAATAA

Transcript

OS493_000613-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008187 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01753 all species →	zf-MYND	MYND finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR052769 all species →	Family	Tetratricopeptide repeat domain-containing protein	Interproscan
IPR002893 all species →	Domain	Zinc finger, MYND-type	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46014 all species →	TETRATRICOPEPTIDE REPEAT PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_000613-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000613-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

31.8Max TPM

11.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.81	13.75
polyp at pH7 6	18	18	8.82	14.76
coral polyp · control treatment	16	16	15.70	31.79
coral polyp · oil and dispersant treatment	16	16	16.16	24.16
coral polyp · oil treatment	16	16	12.26	17.55
coral polyp · dispersant treatment	16	16	11.84	17.64
Polyp	10	10	3.89	9.90

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.75
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.78
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.16
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.80
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.57
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.46
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.96
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.80
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.84
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.35
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.76
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.54
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.16
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.84
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.42
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.92
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.59
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.79
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.42
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.65
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.66
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.12
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.92
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.20
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.18
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.26
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.67
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.95
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.28
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.05
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.66
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.26
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.16
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.36
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.58
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.69
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.46
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.32
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.09
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.24
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.99
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.67
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.72
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.42
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.05
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.26
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.48
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.62
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.09
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.88
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.49
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.61
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.64
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.36
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.81
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.53
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.67
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.57
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.10
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.59
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.47
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.33
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.79
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.94
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.53

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.