Gene detail

Detailed information of OS493_000671-T1 in Lophelia pertusa

Genomic Location: scaffold_1:9351871...9368257
NR annotation: KAJ7394836.1, Rho guanine nucleotide exchange factor [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000671-T1

ATGGCCAGTAAGCTGGAAGACAGTGTTAGAAGCGACAGGGATTCAATGGTTTATGATGATGTAGCATCCCAAGGAGACTTGAGCAAAGACAGCATTACTGAGCCAGAAGACGTACAGGAAAAGGGTGATAGTGGTGCACTTGTTAAAAGAAACAAATGCATCAAAACTCCAGGTCAAAAAGCTTCAGAATCGAAGGAGAGTACTGTCAAGAAAGGGTTGAGTGTACAAAGTAACGCAATTAAGTCAAATAATGTAGATGGAGGACATGGAGAAAAGATTAAAGATTCAGATAGTAACAATGATGATCAAGAATCACACAAAGACAAACGGAAAATCCGCAAAGATAGTGACAAGGAGCTGTGGACGCCAGTGAAATGTGATTCCAACGAGAACATGGATAGTAAAGATAGTAATGATGCAATTAAAACGGGAGAAGTCACGGTTGATGATTCTCTTGACAGTCATCCTACAAAGCCACCAAGACGACACCCTCAAAAGAAGCTGGAAAGAGCGGCAAGTGGAGAACTTGATCAGAAAACTTCACCTATTCACAGCCCTGGAAACGATCCTGTGAAGCCGCCAAGAAGGCGCTTGCCACAACCACCAAAATCTGGGAAAACTCAATCAGAAGTGATTGGTTCCGCAAACAGCGATGAGGCTCTTTCTGTGACAAGTGATGGCTCGGAACAAAAGCCTACAGAAATTGTGTGCAAACCTGTTCTAACATCGAGTCCAAACCAAGATGAGATCCCTGGTTTGTCAGTAGAGACAATTGATAAAATGGATACAAGCCGCAGAGTTCTGTCATTCCTCGACGAATCGTCAGCGGGTGGTGTTAGAAAAGTTGAATCATTTTATGATTTTTTGTACTCTGAAGATGATTCTAATTCTGTTGCAGAAGTAACCTCTCCAATACCTTTACAACAAGGTGACAGAATTGGTAGTGCACTGACAGGCTCAGAGGATCATCTATATGATGCTGTTCCTGTAGAAGACAGTGTTGCAGAGAGCTTTAGCCGGAGAAGTAGTAACGGAACATATGATGAGGTTATTGTCAACCAAGAGGCATATGTTATGCCATCGCATGAGGATGAAAGTGATGAGTTTTCTGAAAGTGACCCTTGGGGCTCAGACTTTGAGACAGAAGATGATGTGACAGATGCTGGAAGCATTAGAACACAGGAAGATTTCAATGATGAGGAAGAAGAAGATCCTTATGATTCAGTGGAAATAAGCCCCATGATGGAGCGAAAAAGGCCGTTTAGGTTTGTGTCTGAGATTACCAGCTTCTCGCCATTTTCAAGTGGAAAGAAGTCATCACTTGGTGTTCCAGGACTGAAGGGCCAGCTAATAGGTTGCCTTGGATTAAGCAAATCACCAAGCCTTCCATACTTAGCCAGCAATCAAAAAGATGATGAAACAGATGCAGTGTATGTTGACCCAGACATCACAGACTCTGTTAACTATCAACAGCCTGTCATGCCCCCCATGCCAGAAGGACTGTCCCCTGAACAGATTAAAAGATACCAGATTGTGAAGTTTATGCTGGAAAGTGAAGCTGATTATATGCGACTCTTAGATCAACTCAGTAAGCAATATGAGTTGCCCATCAGAGAGCGCGATCTTCTTGAACCAAGCAAGATTGATATCATCTTCCAGCATGTTCACAGAGTCTTGCAGTGTCATGCCATGTTCAATATTGCACTGAGTGCTCGGATGGCTGACTGGACCCCGAGGAGAAAGTGGGAGATATCTTATATGCCTTGTGGATATGTGAACAACTTTTCAAAAGCCATGGATACTGTGAAAATTGCCTGTAGAACCCATCTTGCTTTTGCACAGTTTTTGAAGTCCCGTAGGCAGTCAAGCCGTGAACGCGACTCCCTTCACCATTTGATGTTAAAACCAGTTCAAAGGTTTCCACAAATATTAGCTCTTCTTCAGGAATTACTGTTAGTGACCCCCAGGGATCACCCGGACCGTGTCCCTCTACAGCTTGCTCTCACTCAGCTGGAGTGTCTGGCAGAGAGCCTGAAAGAACGAAAGAGAGAAGCTGAGTTGAGGAACAAAGTCAAGCTACTGGATGGATTGGTGGCACAAAGTCACAAGCCTTTAGCATCTGGTAACCGATACTTTATCAGGCAGGATGACTTTGTGCAGTGTACTGTTGAAGGCGAGTCAATCCTTGGGACAAAGAAACGAAGAATAATCATGCTGTCAGACATGTTACTGTGTGTTTCCCTGATTAAAGGGAAGAAAGATCGTGCCATGCACATGGTGATCGACCCCAAAGCAAAGTACAAGTTGAAATGGAATGTGCCGCTCAATGATGTTGATATAGTAGAATATGGTCCAGGTGTTAACATATTGACTAGCTCATACAGGACAACAATTAGCCATTCCAAGGAAGGTCAGTATCGAAGTACTTATAGCGGCTGCCGTGAGCACTTTGAAGATCTGCAGCAGGACTTAGCTGTGATTGGTCAAATAGCTGGTCTCGCTGCTACGCTACGGCGATCATATCGGGTTCTGGATGGCGAAAAAGTTCAACAATGGCACAAAGCCGTGCAGAGGACAATAGAAGAAGAAACAAGACTAGCAAATCTTTATTGGCTGGAGTTATCTTTACCGTCCAAACATGGCCATGTGAACTACATTTTCAGCACAGATTCCCATCGGTGA

Transcript

OS493_000671-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8C033	Rho guanine nucleotide exchange factor 10 OS=Mus musculus OX=10090 GN=Arhgef10 PE=1 SV=2
O15013	Rho guanine nucleotide exchange factor 10 OS=Homo sapiens OX=9606 GN=ARHGEF10 PE=1 SV=4
Q5R5M3	Rho guanine nucleotide exchange factor 10-like protein OS=Pongo abelii OX=9601 GN=ARHGEF10L PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003930 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00621 all species →	RhoGEF	RhoGEF domain	Domain	Interproscan
PF19057 all species →	PH_19	PH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR035899 all species →	Homologous_superfamily	Dbl homology (DH) domain superfamily	Interproscan
IPR000219 all species →	Domain	Dbl homology (DH) domain	Interproscan
IPR039919 all species →	Family	Rho guanine nucleotide exchange factor 10/17	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12877 all species →	RHO GUANINE NUCLEOTIDE EXCHANGE FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0030036 all species →	Biological Process	actin cytoskeleton organization	Interproscan
GO:0051496 all species →	Biological Process	positive regulation of stress fiber assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_000671-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000671-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

26.1Max TPM

10.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.70	24.44
polyp at pH7 6	18	18	12.65	20.83
coral polyp · control treatment	16	16	13.37	26.13
coral polyp · oil and dispersant treatment	16	16	8.25	14.89
coral polyp · oil treatment	16	16	11.24	16.84
coral polyp · dispersant treatment	16	16	8.86	15.60
Polyp	10	10	3.20	6.53

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.44
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.08
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.24
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.77
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.62
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.92
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.13
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.30
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.24
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.85
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.67
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.60
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.26
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.82
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.40
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.18
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.91
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.78
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.55
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.25
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.11
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.53
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.25
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.23
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.15
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.47
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.13
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.24
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.78
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.59
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.59
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.81
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.17
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.14
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.89
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.72
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.81
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.48
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.26
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.96
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.82
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.41
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.09
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.52
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.76
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.70
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.84
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.32
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.34
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.76
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.48
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.90
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.69
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.65
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.02
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.85
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.30
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.60
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.93
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.85
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.26
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.71
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.24
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.71
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.58
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.35
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.83
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.53
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.52
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.43
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.30
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.88
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.76
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.65

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.