Gene detail

Detailed information of OS493_000790-T1 in Lophelia pertusa

Genomic Location: scaffold_2:234056...253146
NR annotation: KAJ7387461.1, THO complex subunit 5 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000790-T1

ATGAAGCGAAGGAGAACACGCACTCCTTCAGATGCAGGTAGTCCTTCGCAGGAAAAGAAAGCGGTGAAATCTCCTCCAACCAGTTCGAAATCTGCTTCTTCAATCAAAGATGGTAATGCTATAAAATCTTCAGATGGCCAACATGCCGCCAACCTAGAGGACATAGAAGTGGAGAAAAGAAGTGCTGCTACTGATGTTGCTTCGTTTGAGAGAGGGACTGAGGAAATCAGAAAGCTTGTGGCGGAGATTCAGAGGGAAAAACTTATGGATGCTGACACAAATGAGTCCAGGATTAGGTGTACCCTACTGTTTACAATCTTGAAGAAGCTCAACCGGCTTTCTCACATGCGATGTAAGAAAGCCAGAGAAAGAACTCAAGAGTCCAAGCAAAAGGTGGATAGTCTTCACTTGCAATTACAGAACCTTCTTTATGAAGTCATGCACTTGAAAAAAGAAATTACAAAATGTCTCGAGTTCAAGTCAAAGGATGAAGAAATAGAGCTTGTTCCAGAAGCTGAATTTTTCAAGGATGCTCCTAAAGAAATATCTAAACCTGATGTCACTAAGGAAGATTCTCATCAACTAATGTTGGCAAGACTTGATTGGGAATTAGAACAAAGAAAAAGGCTGGCTGTACAAAAAGAACAATTTCTTGAAAAGAAAGAAACACTCATGAAAGAGATTCACACCAAGAAGGAATTCTTGGACAGCTTACAACCAAGACTAGAAAATATTTTGAAGGCCACCCAACCAGTCCAGGAGTACATGAACATGCCATTAGATGCTCAGCGGTTACAGCATGAAACTGCCCGATATCTTCCCCAGCCTCTGTATATTCTGTACGTCCAGGCTTCAGCGTACAGTGAGGCGTGTGATCGTCATTTGGAAGTAAAGATTCTGGGTGATTTGGATATTGCAAAAGCTGCCATTGAGACAAAAACTGCAGCAAGAGAAATTGATAGCGACTCAGACCAGGAAAACCCTGATGGACACAAAAGGTCCAAACATAGGAGAAAGAAGGAAGAAGCTCGCTTGGAGGAGAAAAGAAAACTGTTGCTCAAGAAACATCCACTTCAAATTCTGATTCAAGTTCGATGTAAAGTACCAGGACCAGTGTTGGCCAATAGTGCGCTTCTCTCTCCTGAGTCGTTATTAACCAATCTGTTTCCTGATGACGGCGGAGACAAGGCGCCGAACCCATCCAGTCTCTATCAACTTGCTCAAGTTGGAGTTACCACTTTTGCATATTTTGTCAGCCTAGTGGGCAAGCCGTATATGTGGGCTCAGAGGATTTGTGGACTGGACTTTTTGCCTGAGGAATTACATGAAGTTGTGCCGAAATCATCAGTCAGTCTGTCTCACATGGAGGCAACAATCAAAGCCGTCAGAGCAAGAATCCTGGCCAGACTTGCTCTCCAGCAGCAACTCACCTCTTTAGAGGGTCTGACGATTCCAGGAAACAAGAATTCTCTTCAGATGTTCCCGAGCAAGATATCGGCAAAACTGTCTTCATGGCAACCAGCAACATTTGAAGAATTTATGGAAAAACCGGAGTTGAAACGTCTTGTTGACGAAGGATTTATTGAAGAAAATGACATGCTGTTCCAAGCAGTGTTTGAGAGAAGCAAAGTTCACCTCAAGGCATCAGTAGTCTTGTCTCAGGAGTATCCGACAACGCCGCCATTATTCTCAATTGCGGTAACTTGCGGACAAACTGTGATAAGAGACAGCTTCACCAAGGCGATAGAAGCGGAAGTGAATGTTTTCTACCCGGAACTTACCGCGCACGACTCCTCTTTAAATCTCTTAGCCAATCAGCTTCGCCGTTTACAGATGTGTTTTGATATTTATTTGGAGTGTGGCTGCCTGAACGATGTGGAAGGCGCTGAAACGTTCGATCGCGAGAAGTTCTTTCTTCGTGTTAAAAAGGGACGGGATCGAGGCTTACCCTTGAAGTACGACTCAAATCAAGGACTCTTTACTCAAAGATAG

Transcript

OS493_000790-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NY52	THO complex subunit 5 homolog OS=Danio rerio OX=7955 GN=thoc5 PE=2 SV=1
Q13769	THO complex subunit 5 OS=Homo sapiens OX=9606 GN=THOC5 PE=1 SV=2
Q68FX7	THO complex subunit 5 homolog OS=Rattus norvegicus OX=10116 GN=Thoc5 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005018 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09766 all species →	FmiP_Thoc5	Fms-interacting protein/Thoc5	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019163 all species →	Family	THO complex, subunit 5	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13375 all species →	FMS INTERACTING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000445 all species →	Cellular Component	THO complex part of transcription export complex	Interproscan
GO:0003729 all species →	Molecular Function	mRNA binding	Interproscan
GO:0006406 all species →	Biological Process	mRNA export from nucleus	Interproscan
GO:0032786 all species →	Biological Process	positive regulation of DNA-templated transcription, elongation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13174	THOC5; THO complex subunit 5	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000790-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

43.5Max TPM

17.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.56	24.41
polyp at pH7 6	18	18	19.20	29.63
coral polyp · control treatment	16	16	20.74	43.50
coral polyp · oil and dispersant treatment	16	16	16.33	36.40
coral polyp · oil treatment	16	16	17.60	27.08
coral polyp · dispersant treatment	16	16	14.01	28.15
Polyp	10	9	19.46	31.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.20
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.28
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.96
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.94
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.72
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.14
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.86
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.83
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.02
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.03
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.26
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.63
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.49
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.44
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.32
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.08
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.55
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.19
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.05
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.80
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.75
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.63
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.99
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.50
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.71
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.11
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.84
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.27
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.03
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.61
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.96
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.60
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.12
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.89
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.10
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.80
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.43
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.40
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.64
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.43
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.79
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.96
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.56
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.74
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.12
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.73
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.30
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.06
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.08
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.90
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.85
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.78
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.72
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.85
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.43
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.97
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.25
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.79
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.74
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.71
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.35
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.90
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.95
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.83
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.65
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.97
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.56
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.54
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.68
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.93
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.83
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.77
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	31.79
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	29.27
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	25.31
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	23.44
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	19.79
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	18.77
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	18.74
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	17.68
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.76
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.