Gene detail

Detailed information of OS493_000933-T1 in Lophelia pertusa

Genomic Location: scaffold_2:1961999...1986427
NR annotation: KAJ7387598.1, WASH complex subunit 5 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_000933-T1

ATGCTATCGTTGCGGAGCTGTTGCGACTTTCCGACTTTATACCTCCGGTGTTTTAAGCAAGAAACAAGAGAAGACTGCGTTAAATATGGCGAGATCTTGGCAGACTTCTCGTATTTCAAGGGGCCAGATTACTACGAGAACAGGATCGATTCCAAGCCGGAGCTTCAAGATCTTGATGAAGAATTTAGAGAAAATCACATCGAGATCCTGACCAGATTCTATAAAGCCTTTGAAAGTGTCCACAAGTACATCACTGATCTAAATAGATACCTGGAAGATCTTGATGAAGGAGTTTTCATACAACAAACACTGGAGAGTGTACTTCTTAATGAAGATGGCAAACAACTCATGTGTGAGAGTCTGTACCTGTATGGTATTATGCTTCTAGTCATTGATATGAAGTTGGAAGGAGATGTACGAGAGAGAATGTTGGTATCCTATCACAGATACTGTGCGGCCAGAGCAGATGGAGACACCAATATTGATGACGTGTGTAAACTTCTTAGAAGTACTGGATTTTCTTTGGCCCCAGGAGCCAAGAGACCCATCAAGTATCCAGAGGATTATTTTCGGCGCATCTCAGTACCTGATTCATTTGTGGATATGCTGATTGGTCGTCTTCGTTCTGATGATGTCTATAATCAGATCTCAGCCTATCCTTTACCAGAACACCGTAGTACAGCTCTTGCGACCCAGGCTTCCATGTTGTACGTCATCTTGTTTTTTGCCCCTGACATTCTGCAGAACCAGCAGGCAAAAATGAGAGAGATTGTGGACAAGCATTTCCCAGATAACTGGGTGATCAGTGTTTACATGGGAAATGTTGTGAATTTAGTTGAAGCTTGGGATCCCTACAAAGCTGCCAAGACAGCACTGAACAACACTCTTGATCTCACTAATGTCAAAATGCTGGCAACCAGATTTAATGCCAAAGTTAAAAGCCTCAATGCAGAGGTGATGAATTATCTCAAAGAAGGAGTCCTTGTAGAGGAGTATGCATTGGATCACATTCCAAAACTCATGAACTGCATCAGAGACTGTAATGTGACACTACGATGGCTCATGCTACATAACTGTGAAATATTTGACGTACACAAGAGATGCCGTACCCTCAGAGAGTTGGTAACCACTTCAGGTTATGACCCGAGAGCTGTCTTTGAGCTTTTGTTGAATACTGCTCAGTTTGAACTGAAACTAAAAGAGATGTTCAAGCAGATGTTAGCACAGAAGCAATCTCAGTGGGAAAAACATAAAGTAGAAGGAGTTGAGAGGATGGTTGAGCTATCTGAAGTGTTTTCTGGGACCAAACCACTCACAAGAATTCAAAAGAATGAAAACCTTCAAGCTTGGTTCAAGGAGATGTCCAATCAGATTTCCTCATTAAGCTATGATGATTCTACTTCTGCGGGGCGGAAAATGGTACAACTTATTCAAGCACTAGAAGAGGTTCAAGAATTTCATCAACTTGAAAGCAACCTTCAAGTTCGACAGTTTCTCCTGGAGACAAGGCAGTTCCTGCATCAGATGATCAGGACAATCAACATCAAGGAAGAGGTTTTGATTACCATTCAGTTGGTAGCTGACTTGTCATATGCCTGGAACATCATTGATAGCTATTCTGGATTCATGCAGCAAGGAATAAAGACTAACCCTACATTGGTTCAGAAATTAAGAGCTACATTCCTCAAGATGGCGTCAGCCATGGATTTGCCTCTGGTGCGCATTGGTCAGGCTAACAGCCCTGATTTAGTGAGCGTCTCACAGTACTACTCTGGTGAATTGGTGGCTTATGTGAGAAAGGTTTTGCAGATTATCCCTGAGACAATGTTTGGTCTTCTTGCAAGAATCATTCAACTCCAGATCAGTAATGTCAAGGAGGTTCCTACCCGGCTGGAAAAGGATAAATTGAGAGAATATGCACAATTAGATGACAGATACCAGATAGCAAAGTTGACTCATGCCATTTCAGTGTTCACAGAAGGGATTTTGATGATGAAAACAACTTTGGTGGGAATTATAAAGATTGATCCAAAACAGCTTTTAGAAGATGGCATAAGGAAAGAGTTGGTCAGACAGGTAGCGTCCGCCATGCACAGTGGTATCACATTCAATCCAAAGGCTAAGCAATCTGAGCTTGGTGTAAGACTGAAAGAGCTTGGAGGAAGAATGGATGGATTCCGCCGCTCATTTGAGTACATCCAAGATTACATCAACATCTATGGACTGAAAATCTGGCAAGAGGAAGTGTCCAGGATCATTAACTACAACGTGGAGCAAGAATGTAACAGCTTTCTGAGAGAAAAGGTCCATGACTGGCAGTCTGTTTATCAATCAACCACAATTCCAATACCAAAGTTTCCTCCTGTGGATGAATCGGTTAATTTCATTGGACGACTAGCGAGGGAGATTTTAAGAATAACAGACACCAAGACCACGTGTTACATTGATCAAATGGGAGCCTGGTACGACAGTAGGACCAAGCAGGAGGTTATGAATTTACTGATTCTAAAACAGCTTCAGCAGGCGGTTGGTTCGTTTGGACTGACAGGATTGGACAAACTGCTCTCATTCATGATTGTCAAGGAATTGCAGAAATTCCAGGGTCTACTCAGAGGAGCACTGAAAGACAAACTAGTGACAGACACTTTGTTTGGACTTTCTAAACTGCTGACTCCTGTCAAAAGTCTTATTGCTTCACCCTACAGAGTGTACCCTCCAGTTACTCAAAAGCTGGCTCGACTGTGGACTCAGTATTGTGAAGCTATCATGAAGGTCGGGCAGATGCAGCTCATTAGAAGACAGATTGCTAATGAGCTGAACTGTTCTTGCAAGTTTGACTCTGAGGTTCTGCATAATGCTCTGGAAACGTTTAACAACGCACTGTTGCGTGATATCGAGGCTCATTACCAGGATCCCACTCGGCCATATCCCAAGGAAGAGAACCCGCTGATGTTTGAGATGACGTCATATCTTGAATGGGGTGGAATTCACAAGCCACTTACTAAGATTTATATAACTACAAAGAAGTGTCCTTATTTCGCACTGCTGAATTTTCTGTGTGTGACTGCTCAACTGTCAAAGCTGGTCTATGTTAAAAGCGTTGGTACAATGGTAGCTAGACGTCCAACCGATCAAATCGACAGCGCGCCTTTTGTTGTAGGAATGATAACTGTCCTTAAACAGTTCCATTCGGAGTACACGGAACAGTTCCTTGCTTGCTGTGGACAATACGTCAGGTCCCTTATCGAAGCTTCTGCTACTAATGTAAGAAGCCAGGAGATCCCAGCTGAAGTTGTAAACCTATTGGTTTTCATGGAAGACTTTCTCATGTACAGTGAGCTTCCAAGAAAGGTTGTCGAGGCTCACATTCCAAGCTACATTTTCGACCAGTTTCGAGTTCATCTGACGTAG

Transcript

OS493_000933-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q12768	WASH complex subunit 5 OS=Homo sapiens OX=9606 GN=WASHC5 PE=1 SV=1
Q5R5P0	WASH complex subunit 5 OS=Pongo abelii OX=9601 GN=WASHC5 PE=2 SV=1
Q7ZVM1	WASH complex subunit 5 OS=Danio rerio OX=7955 GN=washc5 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002378 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10266 all species →	Strumpellin	Hereditary spastic paraplegia protein strumpellin	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019393 all species →	Family	WASH complex, subunit strumpellin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15691 all species →	WASH COMPLEX SUBUNIT 5	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0071203 all species →	Cellular Component	WASH complex	Interproscan
GO:0005768 all species →	Cellular Component	endosome	Interproscan
GO:0007032 all species →	Biological Process	endosome organization	Interproscan
GO:0030041 all species →	Biological Process	actin filament polymerization	Interproscan
GO:0051125 all species →	Biological Process	regulation of actin nucleation	Interproscan
GO:0140285 all species →	Biological Process	endosome fission	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18464	RTSC, SPG8; WASH complex subunit strumpellin	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_000933-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

28.7Max TPM

16.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.60	22.30
polyp at pH7 6	18	18	16.84	26.91
coral polyp · control treatment	16	16	16.49	23.60
coral polyp · oil and dispersant treatment	16	16	11.40	19.49
coral polyp · oil treatment	16	16	16.28	25.39
coral polyp · dispersant treatment	16	16	16.03	28.72
Polyp	10	10	18.13	26.45

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.30
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.36
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.23
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.05
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.85
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.10
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.59
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.18
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.91
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.73
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.62
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.33
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.91
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.54
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.07
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.46
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.39
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.27
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.23
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.92
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.67
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.78
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.85
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.29
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.51
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.60
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.93
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.80
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.17
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.94
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.68
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.26
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.97
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.49
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.51
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.59
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.17
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.02
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.81
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.98
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.01
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.81
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.46
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.95
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.62
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.50
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.39
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.24
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.41
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.35
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.92
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.76
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.26
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.13
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.80
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.72
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.52
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.93
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.29
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.61
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.55
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.13
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.81
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.60
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.92
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.59
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.46
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.34
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.67
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	26.45
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	26.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	24.47
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	21.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.32
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.82
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.66
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.80
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.