Gene detail

Detailed information of OS493_001023-T1 in Lophelia pertusa

Genomic Location: scaffold_2:3161749...3197426
NR annotation: KAJ7387683.1, Vacuolar protein sorting-associated protein 53 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001023-T1

ATGGCGGCCGAGAGTGGCGCACCATCAGGCGAAATTGAAGATGATTTTCTTGAGGAAAGCCTAACTAAACCGATATTCTACTCGCCAGAAGTTGAAGAGGCTATATCTCAGGTTTTTAAGAGTGACGATCCCTTGGACAGCAAAGATTTCAACCCAGTGGACTATATCAATTCTGTTTTCCCAACAGAACAGTCCCTAGCCAATATAGATGATGTTGTTAACAAGATGAGGCTAAGAATCAGGGGTCTTGATGAAGAAATTAGAACAGTTGTTAGAGGACAGACTAACATTGGTCACGAAGGAAGACAAGCACTTGATGAAGCCAAACAAGCAATTCAACAGTTGTTTGCAAAAATTATTGACATCAAAGAAAAAGCTGACAAGTCAGAACAAATGGTAAAGGAAATAACAAGAGATATAAAGCAACTAGACCATGCCAAGAGGCATTTAACAAGCTCCATTACAACTCTAAATCATCTCCATATGCTGGTGGGTGGAGTGGACACCCTCATGAGTTTAACTAGGAAGCGACATTATGGAGAAGTGGCTAATCTGTTACAAGGAGTTGTCAATGTCCTGGAACACTTCAAAAAGTATTTTGGAATTGGTCAAATTCGACAGCTAGCTGACAAGGTTAAACAAATCCAGAATGAACTTGGCACTCAAATATTGGCAGATTTTGAGGAAGCTTTATCTGTCAAAGGAGTGAAGCCTCCAGCAGGACCTAACTCACAGTTAGCTGAAGCATGTCAAGTGGTAAACGTCTTGGATCCTAAAGTGAAAAATGAGTTGCTTACATGGTTTGTGAAACTTCAGCTAACAGAGTATCAACAACTGTTCAACGACACATTTGAAGTTGCGTGGCTTGATAAAATCGACCGCCGGTACTCCTGGTTAAAGAGAGCTCTGGTTAAATTTGATGAAGACTTTCAAGGAACGTTTCCTTCTGAATGGCATGTAGAGGAGAGAATCAGTGAAGAATTCTGTAGAATAACAAAAAAAGATTTGTCAAAAATCATGACAACAAGAATACAAGAAATTGATGTCAAACTCTTGCTGTTTGCCATCCAAAGAACAACGACGTTTGAAAGTTTATTGGCGCAGAGATTTGTTCATCATGGGCATGAGGACAATGAAGATACAAGGGAGGCAGGTGGCAAGCCCAAGCAGTCCAAGTTCTTGGGGATCATTTCAAGATGTTTTGAGCCACATCTTCATATTTATATAGAATCACAAGACAAAAACCTATCCGAGCTGATGGACAGGTTTGTCCAAGATTTCAAGTCCCTGGGCGTTCCCATGGTGGAAGGAGATGGCAGCAATGTTGTATTTCCCAGTGCTGGCGAACTGTTCGTATTTTACAAGAAGTGCATGGTACAGTGCTCGCAACTTAGCACCGGGCCTCCTCTGCTCTCACTCACAGCAGCTTTCCAGAAGTTTCTTCGAGAGTATTCCACAAGAGTACTCAACAACCATCTCCCTGTCAAAAGCACAGGCGGTCTTGCTAGCATCTTAAAGGATTCTGGTGAAGTGAAATTCAGCAAAGAAGAACAAAGTCTTACATGCTGCATCCTTTGTACAGCTGATTACTGTCTGGAAACAACTCAACAGCTGGAGGAGAAATTAAAGGAGAAAGTTGATCCTGAGTTGGCGGAAAAAATTGATCTCAATGGGGAACAAGACGTATTCCATAGTGTGATATCAAACTGTATCCAGCTACTTGTGCAAGACTTGGAGAATGCTTGTGATGCGCCACTCACAGCTTTAATAAAGGTCAACTGGCAGAGTGTAGAAGCTGTGGGAGATGAGAGTTCTTATGTGACAGCCATCTCTAATCACCTTAAGGAAGCCGTACCTCTCTTACGAGATTACCTGTCGTCCGCAAGAAAATACTTCACTCAGTTCTGCGTCAAATTTGTCAACTCTTTTATTCCACGGTTTATCAGCAACTTGTACAAGTGCAAACCAATCAGCACAGTTGGAGCCGAGCAGCTGTTACTAGATACTCATTCTCTGAAGACAATCCTCCTGGATCTTCCCTCCATCGGCTCCAAAGTACAAAGAAAGCCTCCAGCTAGTTATACTAAAGTTGTGGCAAAAGGAATGAAAAAGGCAGAAATGATATTGAAGGTGGTCATGTCTCCACACGACCCTGCGGTAGGATTTGTAGACAATTACATCAAGTTGCTTGCAGACACTGATACCTCCAACTTTCAGAAACTGCTGGACATGAAGGGCTTAAAGCGCAGCGAGCAACACAGTATGCTGGACCTATTCCGATCCCGTCTCCCCTCCCCTCCGGCAGGCAGTGTACCTGGGGAGTCCGCCGCAGCTAAGTCCCATGCCACGACCGAGCAGGAATCCAGTAGAATAAAGAAGCTTGAGAGACTGATCAAAAAACCGTTCTAG

Transcript

OS493_001023-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZLD7	Vacuolar protein sorting-associated protein 53 homolog OS=Gallus gallus OX=9031 GN=VPS53 PE=2 SV=1
Q5R5J4	Vacuolar protein sorting-associated protein 53 homolog OS=Pongo abelii OX=9601 GN=VPS53 PE=2 SV=2
Q8CCB4	Vacuolar protein sorting-associated protein 53 homolog OS=Mus musculus OX=10090 GN=Vps53 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004029 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16854 all species →	VPS53_C	Vacuolar protein sorting-associated protein 53 C-terminus	Repeat	Interproscan
PF04100 all species →	Vps53_N	Vps53, N-terminal	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031745 all species →	Domain	Vps53, C-terminal	Interproscan
IPR007234 all species →	Domain	Vps53, N-terminal	Interproscan
IPR038260 all species →	Homologous_superfamily	Vps53, C-terminal domain superfamily	Interproscan
IPR039766 all species →	Family	Vacuolar protein sorting-associated protein 53	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12820 all species →	VACUOLAR SORTING PROTEIN 53	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000938 all species →	Cellular Component	GARP complex	Interproscan
GO:0042147 all species →	Biological Process	retrograde transport, endosome to Golgi	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20299	VPS53; vacuolar protein sorting-associated protein 53	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001023-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

23.6Max TPM

8.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.00	9.75
polyp at pH7 6	18	18	7.66	10.87
coral polyp · control treatment	16	16	10.24	23.55
coral polyp · oil and dispersant treatment	16	16	7.37	11.31
coral polyp · oil treatment	16	16	8.73	15.67
coral polyp · dispersant treatment	16	16	8.44	16.49
Polyp	10	10	5.59	8.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.75
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.67
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.60
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.50
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.69
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.40
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.20
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.06
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.65
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.41
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.13
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.06
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.99
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.98
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.72
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.21
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.46
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.41
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.93
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.44
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.11
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.55
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.12
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.63
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.44
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.61
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.44
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.55
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.05
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.36
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.12
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.89
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.50
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.95
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.70
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.82
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.44
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.80
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.71
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.97
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.47
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.47
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.35
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.99
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.82
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.82
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.04
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.80
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.67
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.86
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.20
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.42
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.46
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.66
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.56
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.04
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.98
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.92
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.86
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.69
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.49
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.42
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.69
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.98
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.65
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.44
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.25
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.40
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.38
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.96
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.24
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.54
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.96
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.11
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.