Gene detail

Detailed information of OS493_001159-T1 in Lophelia pertusa

Genomic Location: scaffold_2:5797671...5832107
NR annotation: KAJ7387814.1, Mediator of RNA polymerase II transcription subunit 23 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001159-T1

ATGGGTGGTTGCACACCGCTCTTTGGCGGCTTGTTAGCTCCGCTTGGCGGCATATTCGCCTTGTTGTTTTGTTTATCTGTATCATTTTGGGGTTCAAAAACCCTGGTTGGTGGCTCATTTGCCCAAGTTGGTGGCTCATTAGCCCGAGATGGTGGCTTATCGGTGGCTGTAATGGAGTACTCTCCATCGGAGACGAGGTCAACATCGGAGAAAGCCAGCACAGATGTCTGGCTCGTGATTCTCCTTTGGTGGGAAAACGCTTTGCTGCCAGTAGTTTTCCATGGCCGAAACTCGTTGAGTCGTGTTCCTGTTGGAACTCCTTCAAGGTTTATACAGATGTCCTCTAGAACAGCTGCTGCTAACTCGTTTTCCTGGTCCAATTACAAGATCCCTCTTCTCTGTAATGCCTACAGCACCAACCCAGAGTGCTTCACAGTGCCAATGGCTGTGCTGGTTGAAATGTGTTATGGAAACAATAAAGCTACAACACAGTTACCTGGCCCTTCAAACACACTTGCCGCAGGGCCAACAGTTCCATGTCCAATGAGTCTGTTAGATTCACTCACAGTTCATGCAAAAATGAGCCTCATTCACAGCATTGTTAATCGTATCATCAAGTTGGGCAACTCCCAGTCTTCATTTGCTCTGGCCCCAGCATTGGTGGAAACATACAGTCGCCTGCTGGTCTACATGGAGATTGAGTCACTTGGAATCAAAGGATTCATCAGTTCTTTGCTTCCCAATGTGTTCAAGAGTCATGCTTGGGGAATTCTCCACACATTACTAGAAATGTTCAGTTACCGGCTGCATCACATTCAGCCTCACTACAGAGTTACCTTACTCTCCCATTTACACTCACTTGCTGCAGTGCCCCATACAAACCAGAATCAGCTTCATTTGTGTGTTGAGAGTACAGCCCTCAGACTCATCACAGGGTTAGGAAGCTCTGAAGTACAGCCACAACTGTCTCGTTTTAATCCTGAGCCAAAACAGCTACTGTCTGCTGAATCTGAGGAACTGAACCGAGCCCTTGTACTGACCATAGCACGGGCTATGCATATCACTTCTGCTGATTCAACTTCAAACTGGTATGAAGGAATCCTGAGATCTCTAATTACCAATACTCCACACAGTTGGGCTAGCCACACTCTAGCATGTTTTCCTCCGCCACTTCGTCAATTTTACACACAAAATCCCTGTCCACACGAAACTAAACAAGTACTAAGACAAAGGGTTGAAGACGAGTACAGGAGATGGAAATCAATGTCATCAGAAAATGAAATATTTAATCATTTTGCGGATCCATCCTCAACGAATGTTTTCATTTGCATTTTGTGGAAGATGTTACTGGAATCCAACCGTCTTAGTCCAGTGTGTCACAAAGTTCTGGAACGTTTAGGGGCACGTGCACTTTCTGCTCATGTGCGAGTGTTTGCTGATTACTTGGTGTACGAGTTTTCTACATCTGTAGGAGGAAAACATGTTAACAAGTGCATTACACACCTTAATGACCTGATATGGAAGTACAATGTTGTCACTTTGGACAGACTAGTTCTCTGTCTGGCTTTGCGCAGCCATGAGGGAAACGAGGCCCAAGTTTGCTTCTTTATTATTCAGCTGTTGTTGTTAAAGCCCCATGACTTCAGAACTCGCGTGAATTCTTTCATACGGGAGAACTCTCCTCAACACTGGCTGCAGAATGAATGGCATCAGAAACACATGGCCTACCACACGAGCTACCCTGAGAGATTCTATTTTGAAGGACTGTTAGAATCTGCTGGAGCCTCAGTACTAACAGTGCAATACCTGCCAATCTACTTTGGTAATGTGTGCCTGAGGTTTCTTCCGGTTTTTGACATTGTTATTCAACGTTTCCTGGAGCTCTCGCCAGTGCACAAGTCATTGGAAAGTCTTCTTGATCATCTTGGCTGCTTGTACAAGTTTCATGATCGCCCTATAACATACCTGTATAACACACTACACTACTACGAGCACTGCCTTCGAGAGAAACCCGCTCTCAAGAAGAAGCTTGTTGGGGCAATTATTGGCGCACAAAAGGATGTCCACCCAGCTGGCTGGTGTCTGTCCAAGGGGTACTTGGAGTACCTCTCTAGCTCTGGTGACACCCCCTGGACTCCGGATTTAGCATACTACTGCACTGTGATTGGCAGACTTGTGGACACTTGTGATTGGCGGTTCAACGAATTCGCAAACCCTGTTGCACATGCGCTTCACGTGACGTGGGTGGAGCTGATGGCGTTACCTGTTACGGGTCAGCAAGTTGGAGATGCATTGTTTGACGTCATCTTCAAAGGAAGCTCTGTCACTCACAATACTGAGATCCGAGCAAATATTGTGGAATGGATCAATGCTGTGGGATTGGTATTGTCGTCACTTCCGGAGCCGTACTGCAGCATCGTGTATGATAAAATCCGTATGGCCCTCACCAAAGACCTCTCTGTGAGGGACATATCAACAACTCCAATTATTCTTGAGGACTTTGGAAAAGCCACCCCATTCCCCTACTCGTTTTTAGATTTTTCAACCAATGTAGCTATGCATTCAGAGACCAACGCGGATTATGTCTTGGCAGTCACGCATGCGCTCTGGCACCATGCGAGTATCGGGCAACTAAGTCAGGTTCCACAATTTATTCATGTCCGTGTGTCACCACTGGTTACAAATGAGGCTCAGTTTCTGTACGTGTGTCATCTGGTGGGACCATTTCTTCAGCGGTTTTCCCAGGAAAGCCCCACCACATGTCTCCAAGAGATTATTGTGGAGCTGTATCATCTTCTGGAAAAAATCAACCGAGACGTTCAACATATTCACCACATCGATACAATCTGTGACTTTTTATACCATATCAAGTACATGTTTATAGGAGATGCCATTAAAGATGAAGTCCTGAAGATCATTCCTCAATTACGTCAGTCGCTACAGATTCGGCTGAGATTCATGACCCAGAATATCAAGAGAGATGACAATTCATAG

Transcript

OS493_001159-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P423	Mediator of RNA polymerase II transcription subunit 23 OS=Xenopus laevis OX=8355 GN=med23 PE=2 SV=1
Q5RIW8	Mediator of RNA polymerase II transcription subunit 23 OS=Danio rerio OX=7955 GN=med23 PE=2 SV=2
Q9ULK4	Mediator of RNA polymerase II transcription subunit 23 OS=Homo sapiens OX=9606 GN=MED23 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003031 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11573 all species →	Med23	Mediator complex subunit 23	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR021629 all species →	Family	Mediator complex, subunit Med23	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12691 all species →	MEDIATOR OF RNA POLYMERASE II TRANSCRIPTION SUBUNIT 23	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005667 all species →	Cellular Component	transcription regulator complex	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0010628 all species →	Biological Process	positive regulation of gene expression	Interproscan
GO:0016592 all species →	Cellular Component	mediator complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15166	MED23; mediator of RNA polymerase II transcription subunit 23	-	Transcription machinery	ko03021	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001159-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.5Max TPM

23.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	22.06	31.55
polyp at pH7 6	18	18	20.81	38.41
coral polyp · control treatment	16	16	28.91	63.55
coral polyp · oil and dispersant treatment	16	16	23.64	34.63
coral polyp · oil treatment	16	16	27.10	35.13
coral polyp · dispersant treatment	16	16	21.51	40.83
Polyp	10	10	19.60	41.49

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.36
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.64
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.38
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.60
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.56
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.49
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.57
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.59
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.76
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.51
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.33
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.75
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.58
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.61
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.41
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.31
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.39
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.38
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.41
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.55
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.84
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.63
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.70
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.44
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.76
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.96
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.17
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.96
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.42
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.55
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.39
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.22
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.03
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.16
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.10
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.49
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.08
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.04
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.63
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.48
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.30
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.01
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.60
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.84
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.29
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.26
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.29
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.97
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.78
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.57
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.13
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.99
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.77
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.65
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.63
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.77
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.10
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.99
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.64
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.45
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.83
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	38.05
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.51
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.01
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.29
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.08
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.05
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.13
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.00
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.97
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	41.49
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	34.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.55
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	25.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.61
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.72
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.12
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.07
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.92

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.