Gene detail

Detailed information of OS493_001359-T1 in Lophelia pertusa

Genomic Location: scaffold_3:244792...262444
NR annotation: KAJ7381243.1, Cullin-1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001359-T1

ATGAACACGATGGCTTCTAGGACACAAAATCCTCACGGATTACGTCAAATTACCTTAGATGAAATCTGGGATGACCTTAAAGAAGGAATACAACACGTTTATAAGCAACAGAGTATGTCCAAACCACGGTATATGGAACTTTACACACATGTATACAATCACTGCACTAGTGTCCATCAACAGTCTCAATCCAGAGTTCCTAAACAGAAGAAAGCACCTAACCAGGGTGGAGCCCAGTTTGTTGGCCTTGAATTGTACAAAAGACTCAAAGACTTTCTAAGGAATTACCTCACAGGCATGCAAAAGGATGGTGCAGATCTTATGGATGAGTCTGTCCTAAAGTTTTATACTCATCGCTGGGAGGATTATAGATTCTCAAGCAAAGTTTTGAATGGTGTATGTGCTTATCTTAACCGACACTGGGTTCGAAGAGAGTGTGATGAAGGAAGAAAAGGCATCTATGAAATTTATTCCCTTGCCCTAGTGACTTGGAGAGAGAATTTGTTCAGACCTTTAAATAGACAGGTAACAAATGCTGTGTTGAGGTTAATTGAAAGAGAAAGGAATGGTGAAACCATCAATACAAGACTCGTCAGTGGAGTGATCCAGTGTTATGTTGAACTTGGTTTGAATGAAGATGATCCTTCAGCCAAGGGACCCACCCTCAATGTGTACAAAACATCTTTTGAGTCAGTATTTTTAGAAGATACAGAGCGATTTTACACAACAGAGAGTACAGAATTTCTACGAGAAAACCCAGTCACAGAGTATATGAAAAAGGCTGAAGCCAGACTGTTAGAAGAACAGAGAAGAGTTCAAGTTTACTTACATGAAAGCACACAAGATGAACTTGCCAGAAAATGTGAGCATGTTCTGATAGAGAAGCATCTAGACATCTTCTATTCAGAATTCCAAAACCTCTTAGATGATGACAAGAATGAAGATCTTGGTCGCATGTACAACTTGGTTGCCAGGATACCTGATGGATTAGGGCAGCTTAGAACCCTGTTGGAAAATCACATCACAAGTCAAGGACTCAATGCATTAGAAAAATGTGGAGATCAAGCATTCAATGACCCCAAGGTGTATGTAGAGACGATACTTGAAGTTCATCATAAGTACAATGCACTGGTTTTGACAGCTTTCAACAATGACGCAGGATTTGTGGCAGCCCTAGACAAGGCTTGTGGCAAGTTTATCAATAATAATTCTGTCACTAAACAAGCTCATGGCTCATCCAAGTCTCCTGAACTTCTGGCGAGATACTGTGATTCCTTGCTAAAGAAAAGCTCAAAGAATCCAGAAGAAGCTGAATTAGAAGATATCCTCAACTCAGTGATGGTTGTTTTCAAGTACATTGAAGATAAAGATGTCTTCCAGAAGTTTTATTCCAAGATGTTGGCCAAGAGGCTGGTACAACACAACTCAGCCTCGGATGATGCAGAAGCTAGTATGATCTCTAAACTTAAGCAAGCATGTGGTTTTGAGTACACATCCAAACTTCAAAGAATGTTTCAAGACATAGGTGTTAGCAAAGATCTTAATGACAAATTCAAGACACATCTAGCCAACACAGAACCCTTAGATTTGGACTTTACAATCCAGGTTTTGAGTTCAGGGTCTTGGCCCTTCCAACAGTCAGCGCCATTCTCTCTACCAGCAGAGATGGAAAGAAGTCATCAACGTTTCACCACATTTTACAGCAGCCAACACAGTGGTCGGAAGCTTCACTGGGTTTACCACATGTCCAAGGGAGAACTGGTAACAAATTGCTTCAAAAATCGCTACATTCTCCAGGCATCCACTTATCAGATGGGTGTGCTGCTGATGTTTAATAACTCGGACAGTCTGACACTGGACCAGATTCAAGAGCAGACTCAACTTAAAATGGATATTCTTTCTCAAGTCCTCGGAATATTGTTGAAGTCGAAACTTCTTATGTCTGAGTCATCTGACGATGGCTCTAACTTAGATCGCCACTCATCAGTTTGTCTGCATTTTGGATACAAAAGTAAGAAGCTGAGAGTTAACATCAACGTGCCGATGAAAACAGAACAGAGACAAGAGCAAGAACAAACGCACAAATACATCGAAGAGGACAGAAAACTTCTTATACAGGCTGCAATCGTGCGGATCATGAAAATGAGGAAGATGCTAAAACACCAACCTCTGCTGGCGGAGGTGTTATCGCAGCTGTCGAGCAGATTCAAACCTAGAGTTCCTGTCATCAAGAAATGTATTGATATGTTAATCGAAAAAGAATACCTTGAGCGAGTGGAGGGAGAGAAAGATACTTACGCATATTTAGCGTAA

Transcript

OS493_001359-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13616	Cullin-1 OS=Homo sapiens OX=9606 GN=CUL1 PE=1 SV=2
Q9WTX6	Cullin-1 OS=Mus musculus OX=10090 GN=Cul1 PE=1 SV=1
Q5R4G6	Cullin-1 OS=Pongo abelii OX=9601 GN=CUL1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000554 (this species only)
Ubiquitin family	E3\|E3 adaptor Cullin RING\|Cullin · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10557 all species →	Cullin_Nedd8	Cullin protein neddylation domain	Domain	Interproscan
PF00888 all species →	Cullin	Cullin family	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045093 all species →	Family	Cullin	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR016158 all species →	Domain	Cullin homology domain	Interproscan
IPR019559 all species →	Domain	Cullin protein, neddylation domain	Interproscan
IPR036317 all species →	Homologous_superfamily	Cullin homology domain superfamily	Interproscan
IPR016159 all species →	Homologous_superfamily	Cullin repeat-like-containing domain superfamily	Interproscan
IPR016157 all species →	Conserved_site	Cullin, conserved site	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR001373 all species →	Domain	Cullin, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11932 all species →	CULLIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0019005 all species →	Cellular Component	SCF ubiquitin ligase complex	Interproscan
GO:0030674 all species →	Molecular Function	protein-macromolecule adaptor activity	Interproscan
GO:0031146 all species →	Biological Process	SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	Interproscan
GO:0031461 all species →	Cellular Component	cullin-RING ubiquitin ligase complex	Interproscan
GO:0031625 all species →	Molecular Function	ubiquitin protein ligase binding	Interproscan
GO:0006511 all species →	Biological Process	ubiquitin-dependent protein catabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03347	CUL1, CDC53; cullin 1	-	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001359-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

185.3Max TPM

71.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	47.02	68.79
polyp at pH7 6	18	18	53.00	62.38
coral polyp · control treatment	16	16	81.28	169.53
coral polyp · oil and dispersant treatment	16	16	122.27	185.33
coral polyp · oil treatment	16	16	72.51	94.81
coral polyp · dispersant treatment	16	16	68.81	133.75
Polyp	10	10	52.18	81.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.84
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	56.38
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.26
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.02
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.28
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.79
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.94
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.65
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.36
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.28
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.35
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.54
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.50
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.43
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.89
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.10
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.94
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	62.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.57
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.78
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.65
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.09
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.55
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.10
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.02
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.23
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.78
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.90
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.05
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	169.53
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	142.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	99.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.59
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.53
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.13
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.46
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.27
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.99
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.94
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.63
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.59
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.36
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	60.08
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.92
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	185.33
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	171.05
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	155.32
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	155.22
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	143.02
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	132.14
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	125.26
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	118.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	117.28
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	110.11
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	107.98
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.53
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.36
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.46
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.81
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	91.38
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.74
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.25
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.96
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.43
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.17
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.75
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.41
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.46
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.40
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	133.75
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	95.62
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.25
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	84.21
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	78.41
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.03
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.98
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.81
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.95
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.26
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.26
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.61
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.12
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.67
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.87
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	81.18
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	60.98
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	56.09
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	55.91
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	51.31
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	50.58
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	50.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	46.29
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	44.90
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	24.43

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.