Gene detail

Detailed information of OS493_001396-T1 in Lophelia pertusa

Genomic Location: scaffold_3:634671...648456
NR annotation: KAJ7381278.1, Leucine-rich repeat-containing protein 45 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001396-T1

ATGGAAGAGTTTCATAAACGCTATACCAGAATATGTCGGGAACATCATATATACCCGTTAGAGGTTGTTCAAAATCACATTCGAAGCTATTCAGACGACGGGTTGGTCGGGGAAGGCAGTTTGACTTCTGCTGATGGTATGGCGAAGTTAGATCTCTCCTCTTACAACCTCTCTCCAGAAGATTGTAATGCACTTGTTACCGCTCTTACAGACGATCTGTTCTTTGAAGAGCTAACTCTTTCTGACTGTTTGCTGAGTGAGGAATCGAGCAAAATTCTTCTTCGGGGCTTGATGGATAACAAGGCCATCAAAAGATTAAACTTGAAAGGGAACAACATTCGCTCTGGAGCAGCGGAAGTTTTGGGTCAGTTCCTCAAGAAAAACACGTGTGTTCGGAGTCTTCTCGTTGAGTGGAATTCGCTTGGTTTGTGGGACAATGGAATGAGAGCTTTTTGTGAGGGACTAGCTCTCAATCAAGTGTTATTATTCCTTGATTTGAGAAACAATCAGATCACACATGAAGGGGCAAGCCAAATCGCCATCGCATTGAAACGAAACCAATGTTTGCGAGGTCTAGATTTACGCTGGAATAATATAGGCCTTCTTGGAGGAAGAGAGTTGCTGGAGGCTCTGAAGTACAACAAAAGGCTTGTAGGATTAGAGCTCACAGGCAACAACATTCCTCAAGATATTGTCCAAGCTTTGACCGTCGCTGTCCAACAAAATAGTGACAGACAAGTAACATTTGAGGAGCATCGGGTCAAAACTGAAACTTTGTCAAGAGAATTAGAAATGGCACAGGAACTCAAACGACAGGAGGTATCAAGTTTGAAGGAAGAAATTGATCAACAGAGATGCAGTCAGGAACAGCTAAACAGAAGCACACAAATTAAGATTGATCACTTGAAGTTGGCTTTGGAAGAAAGGAAATCAGCATTTGATTCTTTATCAGCAAAACTCTCCTCTGCAGAATCTGAATTGCTTCTTTCTAGAAAACTGTGCTCTGAACAAAAGGTTGTTGTAAACACACTGACAGTTGAACTGCAAGATGAAAGAGAAACCAAGGCTACTGCAGAGCTCCAACACAGAAAGAAAATGAATGAAGTCCTTGAGAAAAATCATGAGTTGGAAAACATGATCAACACTCTTGAAAGAAGAAATAAGAGCTTTGAGAATAAGATTCATACTTTAGAAAAAGATATTGAAAGCATGGAAACCCATTTTACTGAGAAAGGAAAAACCAGTGATCAAAAATTCCAGGAAGAGTTACTGAACACTGAAAGAAGGCTACAAAAAGAAGTGAGTAATATACAAGAGAAAGCTTTAGAGTACCGTGAAGCCACAAAAGAAAAGACTGCAAAGTTAGAAGAGGAGAGGAATACATTTGAAGAGGAAGTGAGCGGTTTGAAATCTCAGTTAGTCTCTAGCAAGCTTTCATCTGATGAGGAACTACGCAACACCAAGACAAGGTTAAAACAAGAAGACATTGCCAGATCCAGGCAATATGATGAACATATTTCTCAGATCCAGCAGTCACAGAGTGAGTTGCAAATGCAGAATACAAAACAGCTGGCACAAATCACTGATTTGCAGTCACAACTGAACACAGCAAACAGAGACAGTGAAGCATTGAAGAGACAAGTGGAAACTATCAGACAGCAACTGGAGCAGAAGGATGCAGACTATAGAAATGAAGTCAATCGATCAAGAATTGAAATCGATTCAGAAAGAAAAACCCATGCTGAGCTGCGAGATAGAATTGCTGATTTAGAAGATAAAATATCTGAGATGTTGAGGAGACACAAGGATGCCATGTCTATAAAAGACAATGAATTAGAACAACTTAATGAACAACTAAGATGCAAAGAAAATGACATGAAAAGAATTCATGACGAAGAGTTGAAGAGAGCTGAACTTCTTGAGAAAGCTATATTTAGTTATGTATCTAGCACCAAAAATGCTTCACGCCCAGGCTCACCCTACCGAACCTAG

Transcript

OS493_001396-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96CN5	Leucine-rich repeat-containing protein 45 OS=Homo sapiens OX=9606 GN=LRRC45 PE=1 SV=1
Q5ZI11	Leucine-rich repeat-containing protein 45 OS=Gallus gallus OX=9031 GN=LRRC45 PE=2 SV=1
Q8CIM1	Leucine-rich repeat-containing protein 45 OS=Mus musculus OX=10090 GN=Lrrc45 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008074 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13516 all species →	LRR_6	Leucine Rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR052116 all species →	Family	Centrosome and Cilium Assembly Protein	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23170 all species →	NY-REN-58 ANTIGEN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25401	LRRC45; leucine-rich repeat-containing protein 45	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001396-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

33.3Max TPM

8.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.60	10.56
polyp at pH7 6	18	18	8.96	14.48
coral polyp · control treatment	16	16	10.65	33.32
coral polyp · oil and dispersant treatment	16	16	7.89	30.24
coral polyp · oil treatment	16	16	8.98	17.40
coral polyp · dispersant treatment	16	16	5.85	11.49
Polyp	10	10	9.21	20.03

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.56
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.34
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.27
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.73
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.71
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.29
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.92
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.89
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.20
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.00
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.89
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.58
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.09
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.22
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.48
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.06
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.79
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.78
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.90
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.69
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.84
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.70
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.52
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.66
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.60
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.33
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.88
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.63
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.32
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.87
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.05
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.75
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.93
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.67
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.45
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.20
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.03
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.04
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.33
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.22
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.24
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.97
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.72
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.19
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.10
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.24
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.22
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.14
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.26
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.15
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.01
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.35
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.40
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.96
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.32
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.06
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.86
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.11
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.19
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.13
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.15
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.59
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.50
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.41
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.49
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.36
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.98
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.12
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.60
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.76
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.03
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.42
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	16.03
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.84
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.90
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.71
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.37
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.36

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.