Gene detail

Detailed information of OS493_001404-T1 in Lophelia pertusa

Genomic Location: scaffold_3:735612...751115
NR annotation: KAJ7381285.1, hypothetical protein OS493_001404 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001404-T1

ATGGAGCAGGTTCGTATCAGAATTTTAAAGCATTTCAATACCACTTCAGAAAAACACACTGTGATTTTTACTGCTGGTGCTACTGCTGCTTTAAAACTTTTGGCAGAGAGTTTTAATTGGCAGGCAGCCATCAACAAGGAAAGCTGTCATAGAAGTCGTTTCTGTCATCTTCAAGAGAATCACACATCAGTGGTTGGTATCAGAGAAAGTGCTGCTTTAAGTGGGGCACAAATTATCTGTGTAAATGAGAAAGACTTCATGGAACAACTCACAAGGACAAAGTACCCTCTTGAATGGGTTTCTCAAACTCAACAAGGAGCATTATTTGGTAGCAGTCATCTGTGTCGTTGGTTTGTTGTTCTGGATGCATCTTCATTTGTAAGCACTTCTCCCTTGGACTTGGTTTCTTGTACGGCAGATTTTGTTCCCATTTCCTTTTACAAGATGTTTGGTTTTCCAACTGGTTTAGGTGCTCTCATTGTAAAGAACAGTAGCTCGTACATTCTACGTAAGTGTTACTATGGTGGAGGAACTGTGCAAGCTACAATTTCTAGTGAAAGGTTTCATGTCTTGAAGAAAACCCTTGCTGAAAGATTTGAGGATGGCACTGTTCCTTTTTTGGAAATTGTTGCCTTGCAACATGCATTCAATTGGTATGAACAGCTGATAGGATCTATGACAGCTGTCTTGAGTCATACCCACAGCATAGCTTTATATGTGTATAACAAAATGTCTGCAATGACACACAACTCTGGTAAACCATTGTGTAAGATATACTGTGACACTGATTTTAAGGACAAGGCAAGGCAAGGCCCCATAATAAACTTTAACCTGCTAAGAGCGAATGGAGATTTTGTTGGCTATAGTGAGGTAGAAAAGATGGCCAGCTTATATAATATTCACCTAAGGACAGGCTGTTTTTGCAACACAGGGGCCTGTCAGAAATATCTGAGCCTTTCAAATAAGCAAGTCAAGGACAATCTGTCTGCAGGTCATGTTTGTGGGGATAATGTGGATCTTATTGAAGGACAACCTACCGGCTCAGTGAGAATCTCATTTGGCTACATGTCTAGCTTTGCTGATGCAAAAACATTTCTAAATTTCATTGAAGAGTGCTTTCTGGAAAGTGATGTAAATGGTATTTGTCAGCATGGCACCTCCTACACACACCCAACTTTGCACAGTGATGCCACCTTACTCACAAATTTAGTCTTGTTCAAACATTCTCAAGGCACAGCTACATCTGCCCATCACAAAAATAGTGTGTTAGATAACAGCAGTCCCAGCAACTTACTACAGGATTTAACTGTACAGTCAACACCAAACCAGAAAGATGCTCTTGCAACACGTGTCGGTGCTAGAATGCTTGATGATTGCCAAGTGTACAATTCTGGGCTTCTTACCTCTGTTGACAGTCTCCATCATTCAAAAGACCTAAGGTTGGAAAAGATCTGCCTTTATCCCATCAAGTCTTGTGCAGCATTTGAGGTCAGTGAGTGGGAGGTTGGTCACAAAGGATTTCTTTATGATCGTCAATGGATGATTGTCACTGATTCTGGAGTATGTCTGACTCAGAAGAGAGAAACGCGATTGTGTCTCATAAAACCTGTACTGGATCTTGTTAGTGAAGTTATTTCAGTCACAGCACCAGGAATGCCTACTTTGGTGTTGCCATTGTGCTTGCCGTCAGAGAATCAGGAATGTGAAGCAAGTATTTGTCAGACCAAAGTCTGTGGAGATAGGGTCTCAGCCCTGGATTGTGGAGACCATGCTGCCTCTTGGTTGTCAAGTTTTTTAAACAAAAACTGTCGACTTATTCAACACCACAAGGAAGATGGCAGGACTTGTAAAATAGGAAGAGAGAAAGGAAGCAGTTCTCTTTCCTTAGCCAACGAATCACAATTTCTACTGGTAACCATGGCAAGCATTTGTGAACTTCTGACAAGTGTTAAACAGCAAGAAACAGGAAAGGCACCCGTAGAAACAGAGCTCTACATGGACACATTGATTGATAGATTCAGAGCCAACTTAATTGTTAATGGTGGAAAGCCATTCAGTGAAGATCACTGGAAAACTATAAAAATTGGCAATTTAGTTTTCAAGACCCAGGGCAAGTGTAATCGATGCCAAATGGTGTGTGTTGATCAGGAGACTGGAACAAGGAGTGTTCAACCAATGAAAACTCTTGGGAAGCTGAGAGGGTCAAAAATGCCTTTTGGAGTTCACTTGGAACATGTGAAGAATGGAATAAATCCACCAACAATTCTTCATCTTGGTGACTTAGTCACTGTCAGCTTGGATTCTTATTGA

Transcript

OS493_001404-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2VD33	Molybdenum cofactor sulfurase OS=Danio rerio OX=7955 GN=mocos PE=2 SV=2
Q14CH1	Molybdenum cofactor sulfurase OS=Mus musculus OX=10090 GN=Mocos PE=1 SV=1
Q96EN8	Molybdenum cofactor sulfurase OS=Homo sapiens OX=9606 GN=MOCOS PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007189 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03473 all species →	MOSC	MOSC domain	Domain	Interproscan
PF00266 all species →	Aminotran_5	Aminotransferase class-V	Domain	Interproscan
PF03476 all species →	MOSC_N	MOSC N-terminal beta barrel domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005302 all species →	Domain	Molybdenum cofactor sulfurase, C-terminal	Interproscan
IPR000192 all species →	Domain	Aminotransferase class V domain	Interproscan
IPR005303 all species →	Domain	Molybdenum cofactor sulfurase, middle domain	Interproscan
IPR015422 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase, small domain	Interproscan
IPR011037 all species →	Homologous_superfamily	Pyruvate kinase-like, insert domain superfamily	Interproscan
IPR015421 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase, major domain	Interproscan
IPR028886 all species →	Family	Molybdenum cofactor sulfurase	Interproscan
IPR015424 all species →	Homologous_superfamily	Pyridoxal phosphate-dependent transferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14237 all species →	MOLYBDOPTERIN COFACTOR SULFURASE MOSC	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0030151 all species →	Molecular Function	molybdenum ion binding	Interproscan
GO:0030170 all species →	Molecular Function	pyridoxal phosphate binding	Interproscan
GO:0006777 all species →	Biological Process	Mo-molybdopterin cofactor biosynthetic process	Interproscan
GO:0008265 all species →	Molecular Function	molybdenum cofactor sulfurtransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_001404-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001404-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

23.2Max TPM

9.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.19	12.60
polyp at pH7 6	18	18	7.84	14.31
coral polyp · control treatment	16	16	10.44	18.25
coral polyp · oil and dispersant treatment	16	16	9.88	17.92
coral polyp · oil treatment	16	16	10.87	18.53
coral polyp · dispersant treatment	16	16	7.94	15.96
Polyp	10	10	12.87	23.23

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.60
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.59
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.03
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.98
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.96
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.53
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.50
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.55
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.21
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.13
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.83
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.31
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.90
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.15
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.04
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.03
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.51
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.27
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.16
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.76
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.30
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.15
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.13
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.66
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.25
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.08
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.99
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.62
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.20
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.73
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.34
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.70
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.92
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.92
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.53
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.44
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.70
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.12
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.58
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.92
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.92
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.64
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.93
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.79
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.10
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.09
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.01
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.70
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.61
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.92
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.41
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.08
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.80
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.68
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.09
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	23.23
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	22.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.17
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.66
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.06
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.12
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.67
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.52
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.98

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.