Gene detail

Detailed information of OS493_001451-T1 in Lophelia pertusa

Genomic Location: scaffold_3:1780090...1846626
NR annotation: KAJ7381328.1, Structural maintenance of chromosomes protein 4 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001451-T1

ATGGCGGACGTGGTTTGTAACGAACAAACAACTGCAGAGCAGGGCAGCGAAGAGACGATGGACGCGGAACATACAAATATACCAAACGAAATTAGTACCGCTCGCCTAATCATTACAAAAATACTAAATGAGAACTTCAAGTCCTACGCTGGAATTCAAGAATTGGGGCCATTTCATAAGAACTTTTCTTCTATTGTTGGTCCCAATGGCAGCGGGAAATCAAATGTTATTGATGCTATGTTGTTTGTATTTGGTTACCGCTCGAAAATGATTCGGACGAAGAAAGTTTCTCAGCTGATACACAACTCAGAAAACCATCAAAACGTCCAAAGCTGCACAGTAGCGGTGTATTTTCAGAAAATCATCGATTTGCCTGGAGATGATTATGAAGTTGTGGCAGGAAGTCAATTTGTTGTGTCTCGCACAGCACGTAAAGACAATAGTTCTGACTATCTCGTTAATAGCCGTAAAGTGCCATTCAAGGAGGTGGTTAAACTTCTTAAAGATTGTGGCATTGATTTAGATCACAATAGATTTCTCATTTTACAGGGAGAAGTTGAACAGATATCTATGATGAAGCCAAAAGCACAATCAGAGCATGAAGAAGGTATGCTGGAGTACTTAGAAGACATTATCGGATCAAGTCGCTTCAAAGAGCCAATTGAACAGTTAGCTACCGAGGTTGAAGGCTTAAATGAAGCTAGAGGAGAAAAGCTCAACAGAGTGAAAGCTGTAGAAAAAGAGAAAGATGAACTGGAGGGATCCAAGAATGAAGCTGTTGAATACCTTAATATGGAGAACTCCATTACAAAACAAAAAAATGTCTTATTTCAGAGATACATATATGAGTGTGCCTTAAACGAAGAGAAGGCAACAGAGAAGAGAGATGAAATCAAAAAGGGACTTGATGAATTAAAGAAGGAACTTTCAAATTTTACAGACAAAAAGGACACTCAGGCCAAAGAGCACAAGGAAGCTTCAAAGAAATATGCAGAACTTTCTATTGTAGTTGACGAGACCAAGAAGAACTTTGCAGCATACGAGAGAGATGACTTGAAATTTCGTGAGGAATATAAATACTCAAAACAGAATCACAAAAAGATGCAGAAAAATCTCCAAAAAGAAAAAGACAAGTTGGAAGAACTTCAGAATGTTCCTGAGAAAAGTAAAAAAGAGTTACAACAGTTGGAGGAAAAGAAAACTGATTTGGAGGGGAAAAGAAAAGCAGAGGAAGAGAAACTTGCAGAAGTTATGCAGTGTACATGTACCTTTAATGCACAATCATGTAGATGCTTGAAGAGTGAAACCGAGGGCCTCCAAACAGAAAAGGAGGCAAAAGAAAAAGAATTATTAGGATGGAACAAGGTTGTCAATGAAGCCAAGTCGAAGATGGATGTGGCAAAGAGTGAGCTGGAAATTTACAAAAGTCAGAATGAGACAGCTGTGAACCAGCTCAAAGATGCTAGAGGCAACTTGGACAGAGCTCAGGAAACCAGAACACAAAGAAAGAGTGACATACAGTCTTTACAGGATGAAGTTCCAGAATTAAAGAACAGGTTAATAAAGGCAGAAGCCGATTTGAAAAAGGCTGTGGAAGGAGAAAAGAAAGCTTCTGATGAGCTTCGTAGCATACGGACAAAAGTTGAGGAAGCAAGAAGTTCCCTGCAAGCTTCACATAGCAGAGGCAGAGTGTTGGAGGCTATTATGCAACAAAAGGCATCAGGGAAGATTCAGGGAGTTCATGGTCGTCTGGGAGATCTTGGTGCCATAGATGATAAATATGATGTAGCTATAAGTACAGCATGTGGAGCACTTGACAACATTGTGTGTGACAGTATTGACACTGCTCAGAAGTGTATTACCTTCCTCAAGCGTAATAACATAGGGTCTGCTACTTTTATTGGCCTTGACAAGGTAGAGAAATGGAGGAAAGATGCATCCTCAACAATTAACACGCCAGAGAATGTGCCACGCCTATATGACTTGGTCCCAGATGATCTCAAACAAGCCACTAACATTGCCTTTCAGGGATCTAAAAGATGGCGTGTAGTGACATTACAAGGCGAACTCATTGACCAGTCAGGTACAATGAGTGGTGGTGGAAACAAGGTTGTCAAAGGAAGAATGGGATCTTCCATTATGTCAGATGTAAATCCTGATCAGCTTGAAGCCATGGAGAAAACCCTGGAGAAAGAGACTAAGGCAGCTGAGGAACATAGAGAATCAAAGAAGAGGCTTGAAGAGACAGTGGATGAGCTGAAAAAGGAGCTTTCAACTGCAGAGCACCAGTTACAGAAAAATAACATGGAGATCAAGGCTTTGGATGAACAGGAGGTGACATTAAAGCAGCAAATAGTGCATCTAGAAAAACAAGTGAAGGAAAGTACTCCTGACAAGGCCAGGCTTAAACAACTTGAAGACTTTGTTAAAACCTATGAAAAAGAATGGCAGACAGCAGCAGCATCATCAGCTAAGATTGAAACAGAAGTTCACAGACTTCACAAGCAAATCATGGAGATTGGTGGAGCTAAGCTCAAGACACAGCAGGGTCGAGTGGATGTATTGACTAAAGCCATGGATGAGGTGGTAGGACAGATAACCAAAGCAAATGTTGCTATCAAGACTTGTCACAGGAACACAAAAAAGGCAGAAGATAACATAAAATCGCTTGAAAATGAAATTGAAGAAAACAGTGCCAACATGCAGAAGCTTGAGGAAGAGTTTAAGACACTGGAGGAAAAAGCTACTGAAGTACTAGAAGACTATGAAAAGGCTCAGCAAGAAATGTCAGCAATGAAGGAATCTCTGGAGGTTTTAGGAAAGGAACTGGCAGTGGTCGAGCAGGAGGAGGCTAAGCTAAGGAGTCAGGAGGTGGACATTAAACACGAGGTGGAGAAATATGAGACAGTTTTGAAAGAGAACCAACAGAAGATCAAACACTGGCAGAAGGAGTTGAGTAAGTTGGTACTGCAGTCATTGAGTGCATCAGCTGATGCTGAACCAGAAGAAAGCCTTCCAACTCTAACACGTGATGAGCTGGAGGGGATTGATAAAGAAACTGTTATGTATGAAATCACTGTTTTGGAGGAAAAACTAAAGCAGATGAAGCCTAACATGGCAGCCATTGCAGAATATCGTAAAAAGGAAGAAGCTTACTTGGCTCGAGTGAAGGAACTTGATGAAGTGACATCAGATCGTGATCAGAAAAGAAAAGAACATGAGGCTATGCGCAAACAGCGCCTTGATGAGTTCATGGCTGGTTTTTCTGTGATTACTACTAAGCTGAAGGAAATGTATCAGATGATTACCCTTGGTGGTGATGCTGAATTGGAGTTGGTCGATAGCCTTGATCCTTTCTCTGAAGGAATTGTTTTCAGCGTGAGGCCACCAAAGAAAAGCTGGAAGAATATCTCTAACTTATCAGGAGGAGAGAAGACTCTGAGTTCATTGGCTTTGGTATTTGCTCTTCATCACTACAAACCAACACCACTTTATGTGATGGATGAAATTGATGCTGCTCTTGACTTTCGAAATGTGTCTATTGTGGCAAACTACATCAAGGAGAGGACAAAGAATGCTCAGTTTATAATCATCAGCTTACGGAATAATATGTTTGAGTTGGCTGATCGACTCATTGGCATTTTTAAGACTGATAATTGTACAAAGAGTGTTGCAATCAATCCACAACTAATAGCATCTGAAGCCTGA

Transcript

OS493_001451-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P50532	Structural maintenance of chromosomes protein 4 OS=Xenopus laevis OX=8355 GN=smc4 PE=1 SV=1
Q8CG47	Structural maintenance of chromosomes protein 4 OS=Mus musculus OX=10090 GN=Smc4 PE=1 SV=1
Q9ERA5	Structural maintenance of chromosomes protein 4 (Fragment) OS=Microtus arvalis OX=47230 GN=SMC4 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002657 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06470 all species →	SMC_hinge	SMC proteins Flexible Hinge Domain	Domain	Interproscan
PF02463 all species →	SMC_N	RecF/RecN/SMC N terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036277 all species →	Homologous_superfamily	SMCs flexible hinge superfamily	Interproscan
IPR024704 all species →	Family	Structural maintenance of chromosomes protein	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR010935 all species →	Domain	SMCs flexible hinge	Interproscan
IPR003395 all species →	Domain	RecF/RecN/SMC, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18937 all species →	STRUCTURAL MAINTENANCE OF CHROMOSOMES SMC FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0051276 all species →	Biological Process	chromosome organization	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0000799 all species →	Cellular Component	condensin complex	Interproscan
GO:0007076 all species →	Biological Process	mitotic chromosome condensation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06675	SMC4; structural maintenance of chromosome 4	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001451-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

78.6Max TPM

9.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.89	20.07
polyp at pH7 6	18	18	12.05	30.88
coral polyp · control treatment	16	16	10.88	78.57
coral polyp · oil and dispersant treatment	16	16	8.41	59.68
coral polyp · oil treatment	16	16	8.13	20.08
coral polyp · dispersant treatment	16	16	7.56	13.00
Polyp	10	10	8.84	20.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.07
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.12
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.90
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.53
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.31
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.40
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.03
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.53
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.18
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.72
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.26
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.08
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.24
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.02
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.63
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.88
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.42
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.05
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.33
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.34
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.25
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.05
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.47
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.37
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.97
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.96
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.57
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	78.57
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.96
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.10
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.58
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.25
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.57
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.53
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.77
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.24
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.17
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.94
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.24
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.68
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.42
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.99
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.07
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.27
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.98
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.80
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.49
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.73
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.28
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.18
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.12
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.16
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.88
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.59
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.12
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.06
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.37
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.04
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.08
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.14
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.22
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.79
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.66
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.09
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.78
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.48
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.52
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.44
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.19
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.21
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.74
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.53
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.75

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.