Gene detail

Detailed information of OS493_001462-T1 in Lophelia pertusa

Genomic Location: scaffold_3:1985978...2033331
NR annotation: KAJ7381337.1, putative phospholipid-transporting ATPase IF [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001462-T1

ATGTCTTTTGGAAGACTAAAGGATCGTCTGTTGGGGTTTCTTCCTGGAAGAAGGCGATATGAAGATGAATGGCGCACTGTGTATGTGCTAAATAAGTATCCCAGTGATGATGCAGATGTTGAAGTCAAGCAAAGCAGATATGCTGATAATGTCATTGTTACTTCAAAGTACACAATATGGAATTTTTTGCCAAAGAATTTGTTTGAGCAATTTCGTAGAATTGCAAACTTTTATTTCCTCTGCATTGGTGTTATACAGTTGTTAATTGACAGCCCTGTGAGTCCAGTGACGAGCATTCTTCCTCTAGTCTTTGTAATAACAGTCACTGCCATTAAACAGGGTTATGAAGACTGGCTCCGTCATAAGGCAGATAGAGAGGTTAACAACCGGCCGACCAAGGTGATAAGACATGGAAGAGTGCAGGATATTCCATCTAAAAATGTCACGGTTGGTGATATTGTTCAGGTATTAGATGATGAAGAGATTCCTTGTGATCTTGTGGTGATGTCCTGTGATGACTCAGAAGGAACATGTTATATTACAACTGCAAATTTGGATGGTGAAACAAACTTAAAGGTGCGTAATGCACTGTCTGACACAGCAGCCATGCAAACTGCTGAACAGCTCTCACAGTTGATGGCACACGTGGAGTGTCAGCATCCACAGGAGGATCTCTACAGTTTTTCAGGTAGAATGCTAATAACGACTAGAGGAGGTGGAGAACCAGTTGTCAAGGCTTTAGGTCCACAAAATCTGCTTTTGAGAGGAGCACGGTTAAAGAATTCCACATACACTTTTGGTGTTGCTGTTTACACTGGCAGAGAAACAAAGATGGCTTTGAATCAACAACAAGGAGCTCACAAGTTTTCAACTGTAGAGAAGACAATGAATGTGTTCTTGATTGTGTTTCTGATTGTACTGTTGTGCCAAGGAGCACTGTGTGCAGGTCTGATGTTCTGGAAACAAGGCACAGCATCAGGAACACCTTCCTATGTTTATCAAGAAAAACCAAAAGTTACATTTACAGGTTCCAATGGTGTGCTGGACACATTTCTTGTATTCCTTATTCTGTTCAACTATGTCATTCCCATATCATTGTATGTTACAGTTGAGCTTCAAAAGTTCATTGGTGCTTTATTTTTTGCTTGGGACCTAAAAATGTATATGGAGGAGACAGATGAGCGTGCCATTGCCAATACGTCAGATCTCAATGAAGAACTGGGACAGATTGAGTATGTGTTCACAGACAAGACAGGCACACTGACAGAAAATGATATGCAGTTCAGAGAATGTTCTATTAATGGCCTGAAATATGTGGAGTTAAACAGTCAATTGTTTGTGGCAGATCAAACAGATGGTCCCTGCGTTTCCGCTCAGAATGTGCCTTCAGAGGTGATGCAGTTTTTCCTAACACTGTCTCTATGCCATACTGTACAAGCTTCCAAAGACACCAGCCACAATTCTATCTATGATTATCGCTACCAGGCTTCTTCTCCAGATGAGAAAGCTCTTGTGGAAGCAGCTGTTAGATTTGGAGTTACATACCAAGGGAAAATTGGTGATGATATTGAAGTCAGAGTTGATAATGTAACTGAGAGGTACACTCTTCTCCATGTTCTTGAATTTGACTCAACTAGAAAGAGAATGAGTGTGATTGTTAAGTCACCAAACGGTGAATATGTGATGCTAGTGAAAGGAGCAGAGACAGCTGTGTTGGATCAACTGGCCTCTGGACCAAGAGATGTTACTCTTGATCATGTCAATGAGTATGCAGAGAAAGGACTCAGGACTCTAGCTGTTGCCCGTAGAGTAATTTCTGAAGATGAGTATGTTATAATGGATGCTAAGATTAATAAGGCCAAACAAGCTATCAATGATAGAGAAGAGCAGCTTGCGCTTGTTTATGAGGAGGTGGAAAGAGATCTTCATGTCCTTGGAGCAACAGCTGTGGAAGATAGATTGCAAGATGGAGTCCCACAAACAATAATGGCCTTACGAGAGGCTGGTATCAAGGTGTGGGTTCTTACTGGAGACAAGGAAGAAACAGCAGTCAACATCAGTCACTCATGTGGACACTTTAAGAGCGGAATGGAAATGATGTTTGTCACAAAGAAGCAGTCAGAGAGGGAATGTCAAGAAGAGCTTGTTAAATGCCGTGACAGGCTGCAACGTAGGCCTCCAACAGCTAATAAGCACTATGGCTTAGTCATTGATGGTTTTAGTTTAGCTCACGTTTTCAAGGGCTACACAGATCTGTTCGTAGATATCTGCCAGAACTGTGTTGCAGTATTATGCTGTAGAATGTCGCCATTACAGAAGGCTCAGATTGTCCAACTAGTGAAGTGTTCCAATGAAAAGCCAGTGACTCTAGCTATAGGTGACGGTGCTAATGACTGTGGTATGATTCAAGAGGCTCATGTTGGTATCGGTGTGATGGGTAAGGAGGGCCGACAGGCAGTCAGAACAAGTGACTATGCTGTGGCCAGGTTTAAGTTTCTCTGGAGAGTGCTCCTAGTACATGGTCACTGGTATTACGTCAGAGCCGCTGTTATGGTTCAGTACTTCTTTTACAAGAATGTGAGTTTTATCACCCCGCAGTTTTTTTACGCATTTTTCAACTCATTTTCTGGGCAGCCTTTGTACCACGCATTCTTTTTAACAGCTTACAACATTTTCTTCACGTCTCTACCCATTCTTGTGTATGGTATTTTTGAGCAACATGTGAACAGTGATGCATTACAAAGTCAACCTCACCTATACAGGGACGTAAGAAAGAACTATCGATTATCATGGACAGAATTCTTCTTTTGGATAGTTTCTGGATATTGGCACGCGTTAGTTTTGTTCTTTGGATCATATTTCTTTTTCCAAGGTGACACATTAGGACCAGCCATGTGGCAATATGGAAACTGGTCGTTTGGAACATTTGTGTTTACTGTTTGCGTCATAGTCAGTAATCTAAAGCTGGCGCTAGTGACGCATTACTGGACATGGATGACTCATGTTGCTATTTGGGGTTCGATCGCTCTGTTCTTTCTCTCTACTATCACATTCAATAGTGCGACTTGGGAGAGCATCCAGCTAGCATTCAATGACGTGATATCGTTAGACATGTACAAGTTGTTCTTTCAACTTCTCTCTCAAGGCGTGGTGTGGATGGCAATAATATTACTGATCCTCATGGCACTGCTGCCAGACATCATCTTCATGCTGATTGCTCGTCATTTCTATCCTTCAGAGACACAAAAAGTGCAGGCTGAGTGGGGTCCAGCAAACAAGCTCAAGAAGGGTTCAGTCTCGCACCGCAGTGAAATAAGCAACAACAGGACATGCGAATCTCTTGTCATACTGGACTGCGAGCAAGGAAGTACAGTGAACGCTCTCTAA

Transcript

OS493_001462-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y2G3	Phospholipid-transporting ATPase IF OS=Homo sapiens OX=9606 GN=ATP11B PE=1 SV=2
Q6DFW5	Phospholipid-transporting ATPase IF OS=Mus musculus OX=10090 GN=Atp11b PE=1 SV=1
Q9N0Z4	Phospholipid-transporting ATPase IF (Fragment) OS=Oryctolagus cuniculus OX=9986 GN=ATP11B PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000534 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16209 all species →	PhoLip_ATPase_N	Phospholipid-translocating ATPase N-terminal	Family	Interproscan
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan
PF16212 all species →	PhoLip_ATPase_C	Phospholipid-translocating P-type ATPase C-terminal	Family	Interproscan
PF13246 all species →	Cation_ATPase	Cation transport ATPase (P-type)	Family	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR032631 all species →	Domain	P-type ATPase, N-terminal	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR006539 all species →	Family	P-type ATPase, subfamily IV	Interproscan
IPR032630 all species →	Domain	P-type ATPase, C-terminal	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24092 all species →	PROBABLE PHOSPHOLIPID-TRANSPORTING ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0045332 all species →	Biological Process	phospholipid translocation	Interproscan
GO:0140326 all species →	Molecular Function	ATPase-coupled intramembrane lipid transporter activity	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0015914 all species →	Biological Process	phospholipid transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26934	ATP11; phospholipid-transporting ATPase	EC:7.6.2.1	Efferocytosis	ko04148	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001462-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

40.3Max TPM

20.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.12	25.42
polyp at pH7 6	18	18	17.71	25.52
coral polyp · control treatment	16	16	25.61	37.22
coral polyp · oil and dispersant treatment	16	16	20.64	29.78
coral polyp · oil treatment	16	16	21.84	34.81
coral polyp · dispersant treatment	16	16	16.94	32.67
Polyp	10	10	24.63	40.34

Per sample · hover a bar for the full sample record

Show the sample table (110 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.05
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.08
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.37
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.84
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.21
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.10
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.48
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.02
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.65
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.52
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.07
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.08
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.89
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.72
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.20
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.85
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.82
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.81
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.19
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.20
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.80
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.22
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.71
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.70
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.62
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.36
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.27
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.62
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.79
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.73
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.82
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.32
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.69
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.78
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.30
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.72
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.04
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.57
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.69
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.52
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.03
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.70
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.93
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.91
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.73
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.81
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.42
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.13
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.17
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.75
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.68
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.00
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.12
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.10
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.89
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.38
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.67
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.60
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.76
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.18
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.19
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.74
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.04
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.04
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.61
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	40.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	39.15
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	36.71
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	29.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	28.20
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.42
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	19.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.57
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.76
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.15

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Lophelia pertusa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	22	OS493_018954-T1	0.840082301373114
Negatively correlated	0	not in this network	-

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Lophelia pertusa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →