Gene detail

Detailed information of OS493_001500-T1 in Lophelia pertusa

Genomic Location: scaffold_3:2969291...3059769
NR annotation: KAJ7381368.1, hypothetical protein OS493_001500 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001500-T1

ATGGCGACTTTACAAAGTGTAGCAGAATCTTTTGGAAATGCCAAGACAGTACGGAATGATAACTCCAGCAGGTTTGGTAAATATATTGATGTTCATTTTAACAAGACTGGCTCAATTGAAGGTGCCAAGATTGATCAGTACCTGCTAGAGAAATCCAGACTTGTGTACCAGATGCCTGATGAAAGAAATTATCACATATTCTACCGTATGCTTGCTGGTATGTCATCAAATGAGAGAGCGTCGCTTTACTTGACGGATGCCTCAGATTACTATTATCTGACACAAGGCAACTGCATCTCTTGTGAAGGAATGGATGATTCAGACGAATTTGCAATTATTAAAGGGGCAATGAAGGTTTTGATGTTTAGTCAAGATGACAGCTGGAACATTTTCAAGATGCTAGCAGCTATTCTACACATTGGAAACCTTGAATTTGAAGCCACTATAAGGAGTACTGTTGATGCCTGTGATATAACGGATCATGAGCTGGGAAAATTGGTTGCTGGTCTTTTAGAGGTTTCTTATGACAATTTAGTTGAAGCTTTCACAAGCCGCTCAACATTTGCACGTGGTGAAATGATCTTTTCTCCGGTGAGCACTGTAAAAGCTGTTGATATCAGAGATGCCTTTGTCAAGGGAATCTATGGAAGAATCTTTATCTGGATTGTCAACAAAATAAATGCCGCCATTTTCACAGATAAGGTACACCCATCGGCATTCAGATCATCCATAGGAGTTCTTGATATCTTTGGATTTGAAAACTTCAATTCTAACAGTTTTGAGCAGCTTTGCATCAACTATGCTAATGAGAATCTTCAGCAGTTTTTTGTTCAACACATCTTTAAACTGGAACAGGAGGAGTACAACAAGGAGGATATAAAGTGGCAGCATATTTCATTTGTCGACAATCAGAACGTTCTTGATTTAATAGCACAAAAACCCATGAACATCATAGCCTTGGTGGATGAAGAAAGCAGATTTCCAAAGGGCACTGATGCTACAATGTTACAGAAAATCAACACACATCACAAGCGATCCAAACTATTCCTTCCTCCAGTCAATTCAAGGTCTTCAGTTTTTGGTATTCGTCATTTTGCGGGGACTGTGTGCTACAGCTGCAAAGGTTTCCTTGACAAGAATCGTGACACCTTCAGCGCTGATCTTGTTGACTTGGTTGGAGGAAGCAAGTCTGTGTTCTTACTTGAACTCTTTTCCAGAGAAAGAGCCATGGGTGAAGATACAAGAAAACGTTCACCAACACTTGGAGCCCAGTTTAAGAAGTCTCTTGATTTACTCATGAGAACCTTGTCAGTTTGCCATCCTTTCTTCGTGCGATGCATCAAACCTAACGACTACAAGAAACCAATGAGATTTGATCGACCTCTGTGCTGTCGCCAGTTGCGCTATTCTGGTATGATGGAGACAATAAGGATACGGAAAGCCGGTTACCCCATGCGGCACACGTTTAAGGAGTTCATTGACCGTTATTACATGTTGAGTGAAGGCCTGACGCGAGACGAATTAGATTTTCAGGGACTTAAGAATGCTGCAATCAAAATTGCCAAGCGGCTTCTGGGCAACACTGACTGGCAGATTGGCAAAACGAAGGTTTTTCTCAAGGACATGCAAGACATTCAGCTGGAGGATGAACGAGACAAACTCCTCACCAAGCGCGCCATTTTGATTCAGAAAGTTGTACGCGGCTTTTTAATTCGTCAGCGGTACACAAAGATGAAAAGCGGTTCAATTCTTATTCAGAAAACATGGAGAGGCTTTCAAGAGAGACAGAAGTACATTAAGATCCGTAATGGCATGGCTCGACTTCAGGCCACTTACAGAGCTCGTGTATTAGCCTCAAAGTATATCACTTTGCGCGAGCGAATGAAGGTTTTCCAGGCATTTTGCCGCGGATTCCTAGCACGACAGGAGTACAAAAACCGTTTGCGGAGTATCATCAAGATTCAGTCAGGGATACGAGTGGTGCTGGCAAAAAGGAGAACTCAAGAATTGAGAGTGGAGAAAAAGAAACGAGAAGAAGCAGAGAGGTTAAGGAAGCTGGAGGAGGAACGCTTGAAGAAAGCCATGGCAGCTGATGCCGCAAGAAAAGAAGCACAGAGACTTCATGAGGAACGCATGGCCAAAATTGAACAGGAGGAAAAAGAGGAACATGAACGAAAGAAACGGGAAGCTGAGAAAAAGAAACATGAAATAGAAGTTGCAGAAGCCATGGCTAAGAAACGGAGAGAAGAAGATGTAGATGACTCTAAAATGGTTGATGAAATGTTCGGTTTTCTACCAGAGGAGAAGACACAAGCAATCTTATCAGCTCCAACTGCGTTTAAGGATCTGGAGCCTGCGCTTGAAGTTGAGTTTGCTACAGAGGAAATGTCTGCCGTGCCAGCAGCACCTGAGCCCGAAGAAGATGTTTCACGGTTCAAGTATTCCAAGTTTGCAGCCACGTACTTTCAAGGAGGAGCCACTCCTATATACATCAGACGACCACTGAAACAGTCTCTCCTACCACTGACCAGTGAAGCGGACAGCATGGCTGCATTAGCTGTGTGGATTACGATTCTAAGATTCATGGGAGATTTGCCAGAGCCCAAGTACATCACTTCACAACCTGATGCCAAGGACAGCTCCGTGATGAGTAAGATATACGATACACTCGGTAGGAAATACAAAGCTAAGGAAATTGATGGAGTGCAGGATTTTGGGGGCTCCAGTGATTCATTGAGTAAAGAGAAAAGAGAAACGCTTCGAAAAAAAATTGTTTCATTAACACTGAAAAGGAAGTCGAAAATAACTAAGGATGTGACAGCAAAGTTAAAAGAAGCCGACGAAAGTGGTACCTTGACTGAAGGTTATGGTCCTCTATCGGCTCAAGATCGACCGACCTCCAATTTAGAAAAGCTTCACTTCATTATCGGCCATGGTATATTGAGGCCTGACCTCAGAGATGAAATTTACTGTCAGATTTGTAAACAGTTAACTCAAAATCCCTCCAAGTCCAGCCACGCGCGGGGATGGATTCTCATGTCACTATGTCTGGGTTGTTTTGCGCCATCAGAAAAGTACCTGAAATGTTTCATTGGAGACGGGCCCCCCGGATATGCGCCATATTGTGAAGAGAGACTAAGGAGAACACAGCAGAATGGATGTCGACACCAACCCCCCAGCTGGCTTGAGTTACAGGCTACTAAATCCAAGAAGCCTCTAATGTTGCCAATAACATTCATGGATGGAACTACAAAGACTCTTCTGGCAGACTCTGCTACAACAGCTAAAGAACTGTGTAGTCAGCTGGCTGACAAGATCTCACTCACAGATCAGTTTGGCTTCTCTCTGTATATTGCGCTCTTTGACAAGGTGTCCAGTCTCGGTAGCGGAAGCGATCATGTGATGGATGCTATTTCACAGTGTGAACAATATGCTAAAGAGAAAGGAGCTAAGGAGATGAATGCACCATGGCGACTGTTCTTTAGGAAAGAGATCTTCTCGCCATGGCACGATCCAACAGTGGATCAAATAGGCACAAATCTTATCTACCAACAGGTGGTCAGAGGAGTCAAGTTTGGAGAATATCGCTGTGAAAAGGATGAGGACTTGGCAGACGTGGCCGCTAAGCAGTACTATGTGGAGTATGGTAAGGACATGTTACCAGAAAGACTCCTCAATCTACTACCCTCCTACCTCCCTGAGAGTCAACTGCAGGGGGGTAGGGTAGGGATAGAGAAGTGGGCTCACCTTGTAATGAACTGTCACAAAAAGGGATATTACACAGCTGAGAAGATTAATCCTCAGAAAGTCAAAGAAGACATTGTTAACTACGCTCGTTATAAATGGCCGTTATTGTTCTCCAGATTCTATGAAGCTTACCAGTTCTCAGGGCCCAGTCTACCAAAGAATGACGTGATAGTCGCAGTAAACTGGACCGGGGTTTATGTAGTTGATGACCAAGAACACGTGCTACTAGATCTTCAGTTCCCTGAGATCACTACTGTCACAAGCGTAAGAACAATGAAGTCAGAGAGCTCCAGTTTTACACTTACCACTGTCAAAGGAGACGAGTATACATTTACATCAGCTAACTCAGATGACATTCAAGAGCTCGTACAGTTCTTTCTTGAGGGATTAAGAAAAAGATCCAAGTATGTCGTGGCAATGGTTGACTATCAGAGTCCAGCCGAGAGTTCATCATTCCTGAGTTTCAAGAAAGGTGATGTGATCATTCTTGAGAGTGACACAGGTGAGACAGTTCTCAACTCCGGCTGGTGTTACGGCATCTGTGAAAGGACTGCAAGAAAAGGCGACTTCCCAGCTGAATGTGTTTATGTGCTGCCCACCATCGCTAAACCATCATCAGACACTTTAGCGTTATTCAATGATCAGTCACTGGAGAGTTCAGAAAAAATAATCGCAACGACACAGACAGCTATTTTCCAAGAGGAGACGGAAGCGTTCGAGAAGCCGCACACTTTACAGGAATATTCTATCGATCACTTTCTACCACCCCCTAAGAGAACACTTAGCAAAGCATTGCAGTCACAGGTCAAAAGGAGAGACAAGAACATACCATGGACTTTTACGAAGGACCCAATCAAGCAGCCACTACTAAAGCGACTAGCAGGACAGGAGGAACTTGCTCAGAAGGCCACGCAGATCTTCTTGGATATCCTTCCAATCACAAATGCCACAATATAG

Transcript

OS493_001500-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q17LW0	Myosin-VIIa OS=Aedes aegypti OX=7159 GN=ck PE=3 SV=1
Q13402	Unconventional myosin-VIIa OS=Homo sapiens OX=9606 GN=MYO7A PE=1 SV=2
Q29P71	Myosin-VIIa OS=Drosophila pseudoobscura pseudoobscura OX=46245 GN=ck PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000878 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00784 all species →	MyTH4	MyTH4 domain	Family	Interproscan
PF00063 all species →	Myosin_head	Myosin head (motor domain)	Domain	Interproscan
PF00612 all species →	IQ	IQ calmodulin-binding motif	Motif	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR041793 all species →	Domain	Myosin VII, FERM domain C-lobe, repeat 1	Interproscan
IPR000857 all species →	Domain	MyTH4 domain	Interproscan
IPR019748 all species →	Domain	FERM central domain	Interproscan
IPR019749 all species →	Domain	Band 4.1 domain	Interproscan
IPR001609 all species →	Domain	Myosin head, motor domain	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR051567 all species →	Family	Unconventional Myosin ATPase	Interproscan
IPR035963 all species →	Homologous_superfamily	FERM superfamily, second domain	Interproscan
IPR038185 all species →	Homologous_superfamily	MyTH4 domain superfamily	Interproscan
IPR036961 all species →	Homologous_superfamily	Kinesin motor domain superfamily	Interproscan
IPR000048 all species →	Binding_site	IQ motif, EF-hand binding site	Interproscan
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR000299 all species →	Domain	FERM domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR014352 all species →	Homologous_superfamily	FERM/acyl-CoA-binding protein superfamily	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22692 all species →	MYOSIN VII, XV	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005856 all species →	Cellular Component	cytoskeleton	Interproscan
GO:0003774 all species →	Molecular Function	cytoskeletal motor activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016459 all species →	Cellular Component	myosin complex	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_001500-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001500-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

20.3Max TPM

7.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.08	7.49
polyp at pH7 6	18	18	4.55	7.89
coral polyp · control treatment	16	16	9.19	18.57
coral polyp · oil and dispersant treatment	16	16	8.82	13.11
coral polyp · oil treatment	16	16	9.20	15.56
coral polyp · dispersant treatment	16	16	8.22	20.33
Polyp	10	10	2.52	4.54

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.10
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.84
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.76
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.55
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.34
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.25
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.12
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.10
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.82
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.89
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.18
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.79
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.76
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.26
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.57
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.61
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.35
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.11
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.26
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.47
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.09
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.07
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.80
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.33
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.94
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.14
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.84
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.11
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.53
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.09
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.86
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.30
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.20
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.86
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.40
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.69
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.62
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.33
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.71
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.56
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.61
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.07
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.01
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.47
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.03
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.27
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.34
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.19
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.43
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.20
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.08
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.37
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.12
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.01

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.