Gene detail

Detailed information of OS493_001642-T1 in Lophelia pertusa

Genomic Location: scaffold_3:7365627...7376292
NR annotation: KAJ7381494.1, Breast cancer anti-estrogen resistance [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001642-T1

ATGTCTCTTGAAAGACCACTGAGCAGGGCAAGTCTCTCACTTGACACAAATCAGAATTCCATACCACAAGCCATAGAGAACAGCAACAGTGCAGAAGTAAACAACCCAAGGAATCCTGTAGATTTTGTGGCACAGCTGTCAACCATTAGTAATGATGGTAAGCGTCAGTCAACAGGTAGCACCGAGAGTGCAAAGTTGAGTTCAGAAGATGATGACTATGTTGACTACCAAGAGATTTATGGTGATGGAAGGGAGAAACATGTCAATGTGTATGATGTTCCTGTTCAGCCTATTGCACTGGATCAAGTTGGTGAAGGTGCTATCACTAAGCGAACTCAAGTAAGCATCTTACAACGAATCAACATGAGTGCTGTTAAAGGATTAAAGTTGGATGTACCAGAAGCACTGCACCGTTTGAAAAAGCTTGAACAAGCTGTTAATGGATCAGTTCAAAAGCTATTAAGCTTTGTCACAATTACATGGAGGAATCCAATTGTACTCAATCCCCAGCTGGCAGATATCAGGGACATTTCAGGTAAGGCAAAGGTAGCCTTAAGATTATTGACAGAATTTGCTCTCAGTTCTCTGGTCAATGCAAGAAATCTACCAAACCAGGAACTCAGTGGGAAGCTAAGCAGAGCGGTAGAGCCATTACTGGAGACATATTACTCGGTGAAATTGGCATTACAAAGACTTGATGACAAGGGCTGGAAGGTTGCATTGGACAGAGGTAACAAAACACATGATGATCTTGATCTGATTATGGTTCATATCCGTTCTGTTCCTGAGAATTCGCAAAATTTGGCAGCTATTATTCGTTCTGCTGCAACAATATTGTACAACATCTCAACCAAGAAAAACAAAGGAGAGCCGTCCTTACATGACTCAAGGACATCAAGTGAGGAACCCCAAACCTATACCTTAAAGCAAAACAAATTGTTTGTGGCGGAGTCTGAACAGTCAGACAAGGAGACACTGACTCTAATCACAAGTGTCATAAAGGATACTGTTGATGAACATTTTAAAACCCCAGCTAATTGTGGGAAGTGGAGTCCTACAACTGTGCGTCGTGTTTGTGGGATGGGCGCACCTAAGAGGAATAGTAATGGCAGTGAGAGACTTGCTGTTGCCACTGATGAACAAAACATCGCACCAAAGCTTCCACTGCGTTTGCAGTCAAGTAAAGGCAAACCAAAAGATTCAATGTTAGGAGAAGAGTCAAAATCGCCACCACCACCTCCCCAGAGGAAGGACAGCAGTGGAAAGTGTCAACATCTAAGACAGAAAAGCATAGATAAATTTCCTCTTGAAACAACAAATGGTGAAACATCCGAGCCACCCCCAAAGCCAAAGTTAGACAGGAAAAACACATCAAGGAAAAGTTACAAGATTCCTTTATTTTCTGAACACAGACATGATAAAGGGGACATTATTTTGAGAGAGCACAAGACATCTGAAACAGAGCCTTCAACACCTCGGCGAAAATGCAATTCAGATCCAACGCAATTACACGATCACAAAAGTTTGGAAGAAGAACAGAGATCTCCAGAAAGACACAACATAACTGCCTTGTTGAAGCAGAGCACAGTTCACATCTCAGATTCAGATTTACCACAAAGCTTAAAGCAATCAAAGAATGCCCAATCATTATTAGCCTTGCAACTTGAAGAGAAAGGATTGTGCTTTAATTATGACAACTCAGTTGATAAAGCATTTCAACATCGTCCTCTTTCAAACTTGATCAATGATGGTGGTGCATCAAATGGATTTATGGTTTCTCTGAATGATTGTGAACTTTTAGAATTCTATAAGTATGAGATTGATGCACAATTATTTGTGTTAAGCGAGGCTGTCAAAGGATTTTTTGCGGTTGTTGACAAGAATGAAAGTCCCAAGGTGTTTGTGTCAAGTAGCAAGTTTATTGTGTTGAGTGCACACAAGTTTGTCTACATTGGGGACACTCTAAGCAAGAGAATCAAACATGGTGACCTAAGGAGTGAAATAATAGCTGTCACTAATAAACTATCAAACTGCATCAAAAGTTTAGTGAGTGCTACAAAGTCTGCAGCATTACAGTATCCAGCATCAAATGCCATGCGTGAGATGAGTGAAGCTGTAGTTGAAGTAAACAGTATTGCCGTTGAACTGTATCAGATTGTAAAGAAAACCACAAAGATTTTCTAA

Transcript

OS493_001642-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P56945	Breast cancer anti-estrogen resistance protein 1 OS=Homo sapiens OX=9606 GN=BCAR1 PE=1 SV=2
Q61140	Breast cancer anti-estrogen resistance protein 1 OS=Mus musculus OX=10090 GN=Bcar1 PE=1 SV=2
Q63767	Breast cancer anti-estrogen resistance protein 1 OS=Rattus norvegicus OX=10116 GN=Bcar1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003917 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12026 all species →	CAS_C	Crk-Associated Substrate C-terminal domain	Domain	Interproscan
PF08824 all species →	Serine_rich	Serine rich protein interaction domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038319 all species →	Homologous_superfamily	CAS, serine rich four helix bundle domain superfamily	Interproscan
IPR037362 all species →	Family	CAS family	Interproscan
IPR021901 all species →	Domain	CAS family, C-terminal	Interproscan
IPR014928 all species →	Domain	Serine rich protein interaction domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10654 all species →	CAS SCAFFOLDING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0016477 all species →	Biological Process	cell migration	Interproscan
GO:0090527 all species →	Biological Process	obsolete actin filament reorganization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_001642-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001642-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.1Max TPM

21.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.49	20.51
polyp at pH7 6	18	18	15.13	21.36
coral polyp · control treatment	16	16	20.18	31.78
coral polyp · oil and dispersant treatment	16	16	26.88	42.09
coral polyp · oil treatment	16	16	18.71	29.23
coral polyp · dispersant treatment	16	16	43.69	63.09
Polyp	10	10	12.86	16.11

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.51
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.83
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.74
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.65
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.85
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.57
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.57
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.72
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.58
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.05
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.02
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.72
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.17
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.41
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.26
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.19
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.36
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.78
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.13
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.97
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.79
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.68
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.18
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.09
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.56
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.91
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.94
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.78
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.86
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.62
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.47
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.97
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.34
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.31
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.70
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.96
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.57
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.11
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.09
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.74
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.74
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.50
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.25
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.24
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.22
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.03
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.70
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.23
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.67
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.89
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.60
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.73
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.90
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.82
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.11
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.92
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.64
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.33
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.63
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.55
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.51
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.09
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.18
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.02
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.41
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.98
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.75
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.52
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.29
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.70
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	16.11
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	14.56
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	14.39
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.91
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	13.06
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.91
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.71
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.