Gene detail

Detailed information of OS493_001730-T1 in Lophelia pertusa

Genomic Location: scaffold_4:500909...521081
NR annotation: KAJ7375003.1, Rho-associated protein kinase 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001730-T1

ATGGACGAGCGAAAGAGGAGGGAAAATCTCGAGAATTACGTCCGAAATCCTCGGAACGATTTGTACATTGAAGGGCTTTTGGATGGTATTCAGTCGCTGGTGTGTGATTGTGACTTTCCAGCCCTCAGACGAAACAAGAACGTGGAAAACTTTCTACAAAGATATGAGAAGCCAAGTAAAATAATCGAAGAATGCCGTATGAATGCAAACGACTTTCAGGTCGTAAAAGTCATCGGACGCGGTGCTTTTGGCGAAGTTCAGTTGGTTAGGCACAGAGCATCGAAAAAAGTATATGCTATGAAACTTCTTAGCAAATTTGAAATGATCAAGAGATCTGATTCTGCATTCTTTTGGGAGGAGCGTGAAATTATGGCTCATACTAGTAGTCCTTGGATTGTGAAGCTACACTTTGCTTTCCAAGATGCTAAAAATTTATATATGGTTATGGACTATATGGCAGGAGGTGATTTGGTCAACCTTATGAGCAACTATGACATTCCTGAAAAGTGGGCCAAGTTCTATGGTGCTGAAGTAGTGTTAGCACTTGATGCCATCCATCGCATGGGATTTATTCACAGGGATGTGAAACCAGACAACATGCTTCTTGACAAACAAGGCCATCTCAAGCTTGCAGATTTTGGAACGTGCATGAGAATGGACAAGGATGGTATGGTGAGATCAGATACAGCTGTGGGCACACCTGATTATATCTCTCCTGAGGTACTCAAATCTCAGGGTGGCGAAGGTTACTATGGCCGTGAGTGTGACTGGTGGAGTGTAGGGGTGTTTTTGTATGAGCTGCTTATTGGAAAAATTATGGATCACAAAAATTCATTACAGTTTCCAGACGACATCGAGATATCGAAGAATGCCAAGCACTTAATTTGTAGTTTTCTTACCGACAGAACTCAAAGAATTGGACAAAGAGGAATAGAAGAAATTCAAAAGCATCAATTTTTTGTCAATAACGAGTGGGACTGGAACTCTATTAGAGATGCTGTTCCTCCCGTGGTACCTGAGCTGGCTAGTGATGATGATTACTCACACTTTGATGACATTCCTGATCCAGACAGTGGAGAGGAGTTCTTTCCTACTCCAAAGGCTTTTGCTGGCAATCATCTACCTTTTATAGGATTTACTTTCTCAGAGACTGTTGTATGGAGTGACGCACAAACCAAGGGTAATTCTGGTTCAGATGGAATGGTGAGGATGGATGGAAATAGTTCCAGTGGTGGAAATGACAGTCGACCAAAGCTGGAAGCAGCCAACCGTAAACTCAGAGAATTAGAAGAACAGGTTGGTCTAGAAATGCAAGCCAAAGATGAGTTGGAACATAACTACAGAATGGTGAGCACCAAGCTGGAAAAAGTCATGAAAGAATTGGACAATGAGTCTGAGACTAAAAGAAGAGTAGAATCATCCAACAGAGAACTGGAGAGAAATGCAGCATTGTTCAAACATGACTTAAAAGAGGCACAGAGACGGTGTGAGTTTGAAGCTGAAGCCAAGAGAAAGCTTGAAGGCAAAGTACAAGAACTGCAGAGCCGTCTCGATGCAGAACTTGATGCTCGGGACAGAATTTCACAATCGTCGCAGAGTGTCCAGTCCAAGATAACTCAGTTGGAGAAGCAAGTCTGGGAATTGACAGAACAGCTCAGAGTGGAAACTGATGCACACACCAAGGATAAAAAATCCCATAGCGATTTACAAAAGTCGTACACAGTAATGGAAAGAACATACGGAGATTTACAAGACAAAAATAGGATCATTAGTGAACAAAAGCTTGGCTTAGAGAGAGAACTTATCAAGGTGCAAGGAAATCTTGAGGCTGAAATGAACATGAGAAATCAAGCCAACAGTTCTAAAGCAGATATGGAATGTCAGAACAGACTGTTGAAAGACGAGCTTGACCAATTAAAAGCAAGATCTGCGTCAGATGCCAGACTACAGCAAAAACTTCAACAGGATCTTATTAACCTAGAAAAAGCAAAAGCTAACACTGAGTATGAACTAAAGTCTGTCCAGAATAAATTTGAAAAAGTCACAGTGGAGTACAAGCGAGAAATTACCAGTTACCAAACAGAAAAGAATAGGTTATCACTTACTTTGGAAGAGAGGACAGAACAGGAACGAGCTGAGCAAACAAAGACTTTGGAGAGGCTGGAGCAAGAACTGGAGATAAGAGCGAAGGCAGAGGCAGCAGCTGCCGAGGCGGAGAGAGAAAGATCAGTTTTAGCTGTGGATCTTAAAGATTTACAACAGAAACTGGAGAGACTAAAACAAGAATATAACGCCCTTCAAAACAAGAATAAAAGTTTGAACTCAAAGTTGGACTCCGAGAACCAAAGAAGAACACAACTGGAAAGTGACTTTAAAATGAATGCTCAAGAAATATCTGTGCAAAGATCAACAGAAAAACAGCTTACTAAGCAAGTTGAAGATTTAATGGATGAAAGAAAACAGTTGGAAGATGCATGTACAAAACTCAAAAGTGCAAGCGCTGTGGACGATCTTCAAATGAAGGAGCTACAGGACCAGCTGGAGGCAGAAACATACTTCTCGACTCTGTACAAAACCCAAGTCAAAGAACTGAGGGAGGAAGTTGATGAAAAGTCAAAACAACTGATGGAGATGAGTAATGAGATACGTCAGCACAGTGAAGAGAGGGAGTCTCTCTCTGCCCAGCTGGAGTTGACGTTGACTATGGTTGATTCAGAACAGCTGGCAAGGTCCATTGCTGAAGAACAAGTAAGTTAA

Transcript

OS493_001730-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O77819	Rho-associated protein kinase 1 OS=Oryctolagus cuniculus OX=9986 GN=ROCK1 PE=1 SV=1
P70335	Rho-associated protein kinase 1 OS=Mus musculus OX=10090 GN=Rock1 PE=1 SV=1
Q13464	Rho-associated protein kinase 1 OS=Homo sapiens OX=9606 GN=ROCK1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002895 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR000961 all species →	Domain	AGC-kinase, C-terminal	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR050839 all species →	Family	Rho-associated Serine/Threonine Kinase	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22988 all species →	MYOTONIC DYSTROPHY S/T KINASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0004674 all species →	Molecular Function	protein serine/threonine kinase activity	Interproscan
GO:0000281 all species →	Biological Process	mitotic cytokinesis	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005856 all species →	Cellular Component	cytoskeleton	Interproscan
GO:0007266 all species →	Biological Process	Rho protein signal transduction	Interproscan
GO:0018107 all species →	Biological Process	peptidyl-threonine phosphorylation	Interproscan
GO:0030866 all species →	Biological Process	cortical actin cytoskeleton organization	Interproscan
GO:0031032 all species →	Biological Process	actomyosin structure organization	Interproscan
GO:0048598 all species →	Biological Process	embryonic morphogenesis	Interproscan
GO:0072518 all species →	Molecular Function	Rho-dependent protein serine/threonine kinase activity	Interproscan
GO:1901888 all species →	Biological Process	regulation of cell junction assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17388	ROCK2; Rho-associated protein kinase 2	EC:2.7.11.1	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001730-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

28.1Max TPM

15.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.02	23.04
polyp at pH7 6	18	18	12.57	17.67
coral polyp · control treatment	16	16	19.22	28.10
coral polyp · oil and dispersant treatment	16	16	16.25	25.43
coral polyp · oil treatment	16	16	18.59	27.95
coral polyp · dispersant treatment	16	16	16.91	27.35
Polyp	10	10	8.40	16.20

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.04
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.52
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.21
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.66
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.82
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.28
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.99
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.34
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.82
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.25
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.52
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.20
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.53
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.51
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.04
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.35
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.15
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.01
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.64
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.87
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.18
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.10
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.67
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.59
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.95
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.53
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.27
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.65
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.19
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.46
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.97
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.88
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.43
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.01
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.80
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.53
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.76
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.71
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.60
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.41
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.12
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.59
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.04
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.27
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.87
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.95
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.48
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.81
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.60
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.36
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.12
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.64
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.15
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.60
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.24
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.63
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.96
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.93
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.41
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.19
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.07
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.99
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.29
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.69
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.30
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.22
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.54
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.12
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.20
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.57
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	10.86
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.44
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.20
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.77
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.06
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.17
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.17

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.