Gene detail

Detailed information of OS493_001997-T1 in Lophelia pertusa

Genomic Location: scaffold_4:3762644...3775657
NR annotation: KAJ7375252.1, letm1 and EF-hand domain-containing protein 1, mitochondrial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_001997-T1

ATGGCGATGTTACAACACTCCTTCTGTCTGCGAAGGTTGTGGCTTGCTTCTTCGTCGCACTTTCGGCATGGATGCCAATTGTCAAGTTATTTTTCTTGTTCTGGATATGATCAGGAATCAAAGAGTAATGCTCGCCAACAACATTGTAACCACATAGATCAATTCAGGGATAGAAATGTCATAAGCTCTGTAGATCACAGTCCATCCATTGGTCTGCAATTCAATACTCGTCAGTCCACACAAGGATTCAGGCAGGACTGTTTGTATGGTAGGTCTGGTATCTCACACAGCATACAACAAGCTGGTTTCCCTTTAATCACCATGAACAGGACATTATTTGATAAAAATGTTCTTAGCATAGAACCTTTGAAAAGGTATCCCTGCAATCATCAAAGAAGGACATTTTTTACCAGTAGTACAAGGTGCGACCCCTCTTCTAACAAATCAGCAAAGAATACAAAACTGTGGGAAGACGAAGGAAATAAATCTAAAGTAGAAGAGGCTGTTGAAGCCATAAAAGAAAAGAAAGAAAAACTGAAAGAAAAAGCATTTCAACTGGAGTGCAGTCCTGAAGAAATAGAACCAAAGGTTGCTGTTTCAACGACACCGAAGAAGACTATATGGCAAAGGGTTAAACATGAGGTTTTGCACTATGCCAATGGATTTAGACTTCTTTTTTTGGAAATAAAAATCGCTGCTCGGATGTTGTGGCAAATTATGAATGGAAGGATATTGACAAGACGTGAAAGAAGGCAGTTTCTTCGCACAGCAGCAGACATATTCCGTTTGGTTCCATTTTTGGTGTTCATACTTATTCCATTCATGGAATTCATGCTGCCTGTTGTCATTAAGCTCTTTCCAAATATGCTGCCAAGTACATTTGCGGACAAAACTAAGAAGGAAGAAGACAAAAAGAAACAGTTGAAAGTGAAAATTCAGATGGCAAAGTTTTTACAGGACACAGTAGAAGAAATGGCAGTAACAGCCAAGCAGAAGAAAACACAGGAGGTTGTTGCTGAGTTTGCAAACTTCTTTGAAAAGATCCGGAGCAGAGGACAGCAACCCAGCAATGAAGACATCCTAAGATTTTCCAAACTGTTTGAGGATCAAATCACCTTAGACAACATGAGCCGTGCTCAACTCAAAGCAATCAATAGACTACTGATGTTGCCGACCATTGGAACAAACAACTACCTGAGATTTCAGCTGCGGATGAAATTACGTCAACTTAGGGCTGATGATTTGTTAATTCAGAGGGAAGGTGTTGATAGCCTCACAGAACAAGAATTGCAGTCAGCTTGCCAGGCTCGTGGTATGAGAGCTATTGGTGTTCCTGCAGCCAGATTAAGGTCCCAACTTCGCCAGTGGCTGGAACTGCACTTGGATGAACAAATCCCAGCATCTCTGTTGCTCATGTCCAGAGCATTGTATCTTCCTGAAAATGTCAGTAAGGTTGAGCAGCTCAAGGAGACATTATCACAACTGCCAGAAACCTTGGTTGAAGAGGCTGAAATAAAAATCTGTGAAGTTTCTGGAGAGCCAGTTGATAACAAAGTTCGTTTGGGTGTTCTGAAGAAAGAGGAGCAAATGATTGCTGAGGAAAATCAAGAGCTTCTGCAAGAGGAAGTGGAAAAAAAGAAAAAGATTGAAAGCATTGCTGCTGAGATTTTAGTGGACAAAGCTCCGGAAGTGAAACCAACTGCTGATGAGGATATTTCTCAAGAGGACTGGTTATCAATTAAAGCAAGTCTTGATCAGGCTAATGAACGGGATGAACTGGAGAAAATCAAGGAAGACAGAGTGGAATATCAAGAGGAACTCCGTGAGCTGGAAACTGAAGATGAAAAACAAGTGCTTAAGGAATCGCTTGGTTCATCTCGGCTCGGTAAAAAGGTTGATGTGATGATAAATAAGATCGAGGATCGGTTGAAGCTGATAGAGACTGAAATAGAACAACCGCTTGATGCTGATGGTGATGGCAAGATCAGTTTACAGGAGATGATCTCGGGTGTACGCAGATTAAAGGACGCTCCGAGTGAAGCTAAATGCCAAAGAATAGCCGAGATGCTTGACAAGGATCATGATGGCGCTCTGGATTTAGTTGACGTGGCCACGGTTGTTGAGCTGTTGTCTATGGAAGATGTCGATCTTACTCCGGAACAAATAAAAGATATTATTGACTTACTGGAGAAAGAAAGCAAGGTGCGAAAGGCTGATGGGAGGAATCAGACAAAGTCACTGACAGAATCGACTAATATAATGAACTCATGCGCCATACCTTTGTATTCAATGATTTTTTATTATTTCATTAATTTGGTGTTAACAGCCTTAAATATATCAATCGTAAACAATCGTACATTTTCGCTTGACTACCCTGGGTGGCAGAGGCTTTTCTTACCTTTTCTTTTCTTACGGGGGCTGTAA

Transcript

OS493_001997-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZK33	Mitochondrial proton/calcium exchanger protein OS=Gallus gallus OX=9031 GN=LETM1 PE=2 SV=1
Q0VA06	Mitochondrial proton/calcium exchanger protein OS=Xenopus tropicalis OX=8364 GN=letm1 PE=2 SV=1
Q0VCA3	Mitochondrial proton/calcium exchanger protein OS=Bos taurus OX=9913 GN=LETM1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005018 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07766 all species →	LETM1_RBD	LETM1-like, RBD	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR033122 all species →	Domain	LETM1-like, ribosome-binding domain	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR044202 all species →	Family	LETM1/MDM38-like	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14009 all species →	LEUCINE ZIPPER-EF-HAND CONTAINING TRANSMEMBRANE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0043022 all species →	Molecular Function	ribosome binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0005743 all species →	Cellular Component	mitochondrial inner membrane	Interproscan
GO:0006875 all species →	Biological Process	obsolete intracellular metal ion homeostasis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K17800	LETM1, MDM38; LETM1 and EF-hand domain-containing protein 1, mitochondrial	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_001997-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

50.8Max TPM

16.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.59	14.63
polyp at pH7 6	18	18	14.07	19.48
coral polyp · control treatment	16	16	21.24	50.82
coral polyp · oil and dispersant treatment	16	16	26.02	42.15
coral polyp · oil treatment	16	16	15.65	25.55
coral polyp · dispersant treatment	16	16	19.19	35.45
Polyp	10	10	8.73	17.79

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.63
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.12
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.68
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.59
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.09
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.50
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.20
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.78
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.26
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.55
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.48
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.37
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.33
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.31
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.10
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.79
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.78
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.24
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.12
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.74
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.60
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.04
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.73
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.46
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.82
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.64
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.36
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.54
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.03
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.13
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.10
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.57
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.28
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.15
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.82
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.36
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.78
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.92
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.79
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.59
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.51
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.07
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.73
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.64
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.58
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.55
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.49
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.99
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.73
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.04
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.28
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.87
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.84
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.77
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.88
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.29
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.45
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.74
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.37
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.32
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.09
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.74
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.46
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.98
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.65
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.43
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.91
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.28
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.16
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.52
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.10
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.36
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.29
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	6.96
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.79
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.70

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.