Gene detail

Detailed information of OS493_002084-T1 in Lophelia pertusa

Genomic Location: scaffold_4:4892185...4912289
NR annotation: KAJ7375333.1, hypothetical protein OS493_002084 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002084-T1

ATGCAACGCTACCAAGCCTATGCTTCTAAGAATGGCCAGCCTCAGAAAGGGCAATTGTGGCCTCCATTTCTGTCTCTTAAACCAATCACTAAGAAGTTTTGTGGATTAACAAAGATTCTCCACTCCAAGATACTGCATGGAGTGTTCTTTTTCATATTCCACAAGGCTGTGGAGGATATTAATTCCTTGGCAGATGTAGTGCATCTTCATTCCACACCTCATGCAACTGGTGACGAGTCAAGGGATATTGGCTGCATTATTGTGGACCGCTGCATTGACTTTCTTGACACTTATGGTAAGGATGTTAAAGACCTCCACCAGATCAGTACCCATCACTGTTTGAACAGAGAGCTGATATACAGGCTGCGACAAGACCCCTATGCTCCTCTGCACCCTGAAACAGACTCGCCTCACCATGTCTGTGCGGCTATGGCAGATGCTCTGCTCAACCACCATCTTATGAAGCCTCCTCTCTTTGAGCCGTTCCTCCCGTTCATGAACGGTGTGCTCAATAGTGCCCTTCAGAACCAAAGCAGCACTCAAGAGAAAATAGCCCAGCTACAGCACATCCAGTTTCTGATAGAACAACAGCCAACTCACAGACGAGATCTCATTACAAAACTCACCAGGCATCTTGTCAGTGTCTCGGAAAGACTCAAGATACCATCCAAAAACTTGGCTCTCGCTAGCGATGAAAACCAGCCCTTGGAACTCTCCATGTTACTGATGTATCTCAACAAATATCATGAATGGCTCTTCAGGACTCACCAAGTTCCACCTGGTTGGCCAAAGACTATCAGTGATTTAGGTTTCTGTTCCACCAGCATGGTGGTAAATGTCAGGCATATAGTCCAGGCGGTGCAAGAACCAATGGACACCAGCGATGGCAGTGGAAGTGGTGGTGTCGAGAGTACAACCTCACCTGGATCACAGTCGATCAAGAGTGGCGTTAAGATGCTGTCTATTGAGTCACAGCAAAGCAGTGGCTTGAGTATAGAAGATACACTATCATTTAAGGGCTTGGTACAACAATTCGTCAGTGTAACCAATGCAACTGAAGCTGCCACAATAAACCTTCTGAAAGCTTGTAGAGGAAACCTGGAAATGGCCCTCAATGTATACTTCAACAAAGAAGAGGCCATGCCTGACTTGGAGCAGGCTGTAGGTGATGTTGCCATGGAAACAAGCTCTTCTTCGATCACGTCATCTGGAGCCGCCCTTGGGACCCCAGACAAGTCAGTAGACTCGAGTGCGTGCCCGGTAGAAGGAATAAACCAAAGTATCTTGAGCTTGCTGGTGAAGCTGATGTCAGTGATGGCTAATTTCACTGCCTCGTCACAAGGAAGGAACCCCGCCTATGGTGATGGGGTTCAGTACCTGTCAGAGCTGTTGGATGTGATCAGAAACTCCAGTCCCGAGAATGCTGCAGCACTGCGCAAGCTCCAACCAGCACCCGGTCAGACAGGCGCCAGTCCCTCCTCTCCTGATGGCGAGGTTGATGATTCTGTGGCCAGGACTATGCGCAGACGACAGCTCGCCAGGGAACGCCAGCAGAAACTTTTAGCTGAGTTTGCTTCCAAGCAGAAAGTTTTTATGGAGAAAACCTTGAAAAAAGATCCAGATGCCTTGGACAAGATGGCTGTAGATGGTATGAACAATGTAACAACCGAAGAATTGTTTGACTGTGTTATTTGTGGACAAACATCGACATCAACAGAAGGCAGACCAATTGGGCTGGTGGCTCTACTACAACCTAGTGCAGTGCTGAAGCATAGGGCTCTTCATCTAAGACACACACAGCTTCCACTAAGCCGCGAAGAAGAAGAGGCTCGTGTCATCAACTGTGAAACAACGTTCAAAAACAGATTTGAAGACTTAAGGAGACGCTTTGACTTGATTCCAAGTCTGAATGCATCTGCAAGTGGCACAGAAGGTGGAGTTCATATTCAGTCTTGTGGCCATCAGCTTCATGTAGACTGTTACCAATCGTATCTCAAATCTCTTCAGGAAGAAGATTCTAATCAGCTTCATCAACTGCAGCCTTACAACCCAAGAAATGGAGAATTCACTTGTCCTTTGTGTCGACAACTTGGTAACTGTATACTGCCCATTGTACCCACGCAGATCATGCCAACTGGTAACACAGCATCCAAGAATACAGTAAAAAGCCACAAAGAACAGACAAGCAGTCTGCATGAAGTCCTGAGGAAATTCAAGCTTAATACCATCACTAAACTAACAGCCAGTGCATTCAACTTCAATGTGCTCGGTGCAGCAATCAAGGCTGTAGTAGAATCCGTGTCTGCATTGGACGGGGAAAGTCACAGGTGCTCAGCTGAGAAGAAGTTCAGCCTGCTTTACAGAATGGCCAGGAGATGTGTTGATACAGAAATTCTCTGTAATAGTTTAACACCCCCACCCACTCCACCCCTCAAAAATATCAAAGTAACAAATATTTGGGATGCAAACATCACTGACATCAGGAACTGTTTTATTTGA

Transcript

OS493_002084-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1QJX5	E3 ubiquitin-protein ligase ubr3 OS=Danio rerio OX=7955 GN=ubr3 PE=2 SV=2
Q6ZT12	E3 ubiquitin-protein ligase UBR3 OS=Homo sapiens OX=9606 GN=UBR3 PE=1 SV=2
Q5U430	E3 ubiquitin-protein ligase UBR3 OS=Mus musculus OX=10090 GN=Ubr3 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002540 (this species only)
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14555 all species →	UBA_4	UBA-like domain	Domain	Interproscan
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR009060 all species →	Homologous_superfamily	UBA-like superfamily	Interproscan
IPR039164 all species →	Family	E3 ubiquitin-protein ligase UBR1-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21497 all species →	UBIQUITIN LIGASE E3 ALPHA-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0000151 all species →	Cellular Component	ubiquitin ligase complex	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan
GO:0071596 all species →	Biological Process	ubiquitin-dependent protein catabolic process via the N-end rule pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002084-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002084-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

111.0Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	18.85	34.30
polyp at pH7 6	18	18	18.22	34.88
coral polyp · control treatment	16	16	15.45	39.16
coral polyp · oil and dispersant treatment	16	16	13.38	28.25
coral polyp · oil treatment	16	16	14.68	29.68
coral polyp · dispersant treatment	16	16	10.12	20.04
Polyp	10	10	17.27	111.05

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.36
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.41
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.38
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.53
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.08
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.16
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.80
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.28
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.95
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.30
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.88
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.78
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.30
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.24
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.56
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.01
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.77
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.63
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.13
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.73
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.16
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.39
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.70
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.01
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.57
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.67
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.53
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.32
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.67
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.25
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.95
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.58
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.64
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.07
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.02
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.88
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.67
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.70
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.64
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.66
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.94
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.16
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.68
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.13
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.01
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.62
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.81
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.39
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.87
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.70
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.72
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.50
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.85
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.06
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.98
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.09
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.73
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.01
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.22
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.32
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.94
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.53
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.32
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.13
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.24
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.55
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	111.05
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	25.74
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.25
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.77
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.63
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.20
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.67
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.89

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.