Gene detail

Detailed information of OS493_002362-T1 in Lophelia pertusa

Genomic Location: scaffold_5:1029660...1039425
NR annotation: KAJ7365650.1, Isoleucine--tRNA ligase, cytoplasmic [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002362-T1

ATGGTTCTTAGGCAACTAAGCATGATGGATGATGGGGACATAGTCAAAGAGGGTCATCTTCGACGACTAAAGACCCAAAAGAAGCGTTTCTTTGTTCTGCGTTCGTCGCCAAGGAAGGGAAAATCTCGACTGGAATATTACGAGAGCGAGAAAAAATTTCGTTTGAAAGGTTCTCCAAAGCGAGTGATTTACCTCGCGAGTTGCCTGAACATCGCGAAGAAGGACGATTCGAAGCAAAAATCGGTGTTCGCTTTGTACACGCGAGAAGACGTGTTTGGTTTGATCGCAGAGTCAGAGGACGAGTTAAATGCGTGGCTGAAGAGCCTGAGGATAGAACAGAAAAAAGATGAAGTCCTGAATGCATCTGTGTCAACATGGCCAGTTTCTGTGAAACCAAGGGGACTGGGCACCAGTAAGAATCTCACTGGGCAATATGACCTTCAATTGTCCACCTGCACTTTAGCATTGGTTACCAAGGAAACCAAAGAGGCAGTCACCGAATTACAGCTTGTCAGTATCAGACGATGCGGACACACAGACTGTTTCTTCTTCATGGAGCTTGGGCGGTCTGCGGTTACAGGGGCTGGTGAACTGTGGATCCAGGTTGACGATCAGATTATTGCACAGAACATGCATGAAGCTATACTGGGGGCCATGCACAACATCTCAACACCCGACATTCCACCAGCTGCCAGACGACGTTGTGCAAGTGAAGGGAAAAGAGGGAAGTCGCGACCACGCCCTGTATCAGCCGTTATCTATCCAACCAATCGCGGCCGGTCGGATACCGAGCCAAGCTCTCCTCAAAGCCTGTTTCATGCCAGCTCGTCGACTTCCACCAGGAATTTATCAGAAAATGAAAGTCCCAGGAGTAAAACATCTGTTCTGAATCGTTTATTGCCACGTAGAAGGTCGAAGGAAGTTATAAATGTAAACTTGGACAGTCCAACCAGAAACCAGGAAGAACAGAGTTCACACTTCAGTGACAAAGTATTGATAAGACCGCCATCAAACAACGCTTCTTCAATGGAACAGAAAATTGAGCAGCCAGAGTACATGAATGTTGGACCAGAGAGCGTGGAAGAGCCGTCCAGTGTAGAGGATTACATGAAGATGGGTGGAGACAGACGTAAGAGTACTGACTCCTACATGGACATGGAACCGGCGAAGTCCAAAGCTATCAAAGCATTCAGAGACCAACAAACACAGCCAACCACAAAAGTGACGCAGACCACCCCCGAAGGGGGCTACATGGACATGACGTCACAACAGTTTGACAAACAGAATGGAAATGCCAAAACTCAAAGTTCAAGCACGCGCAGTGAGTTTGTACAACAGAAGAGGTCTTCGTCACCTAGGCAACTGAGGACCACCGAGAGCGCCCTGCCCAATAAACCGGACATTCGCGAGTTTGTGTGCATCAAGAAATCTCCGTCCTCTGCCCGTAAGACTTCTAGCCAGGATTACGTCACAATGAGCCCGCTGGCTGTCCGGACAGAGGAATCTCGAAGCTACGTGAACTATTCACCGGGGTCGAACCCCAAGAGATCCCTATCCCCGAATTCCGATTCGACGAATCAGCGGGAAGACTCTAATCGTTATTACGTGAATTTTACTCCCGGGGAGAATTTCGCGAACAGAGCAAGACAAATCGAATCTCCGAGTCCACGAAAACTTATTAACAGCTCAGTTGATGACTCATCTTCCTATGAAGACATGCACAGCTATGTGAATTTTAGTCCTGGGAAAATTGTTGAACAGAAAGCCACGGGCAGCAATTTTAGAAAGCATAGCTTGGAATCTGTGCTTTTAAAAATTCCCCGCGAGTACGAGAACGTTGATTTCAGCGGTATCGCAAAAAGCAGAAGCGCAGTAGATGTGCCCGAATACGTTAATTATGTTCCAGGGAAGCCCTTTGAAAGCAGCGACAATGTCAGTTCGTTAGCCAATGGCGATAAGGACACAAGCGTAGTGAAAGCGCTTAATTACGTCAATGTTTCGCCAGGGAAACCTCTAGATGAAAACGAGAGATGGCGAAGATCACCTCGTTCTAACAGACGAGAGAGCGAACCAGCGAGGTTAGAGCCACTAATTATGTGCAACTCACAACTGGATACAACTCAAGAAGACAAGGAAATCAAACAACTCAACTACGTTATGCTTGACTTGAACAATGCTGAGAATTCATCGGAGTCTCCTTCCCGACAACGCCGGCGGCCTCCAAATATTGACTTGAGATCATGCCGCCGAGCGTCGCCTGGGCCCAAGTCTGCGCCCGTAAAGAGCGCGTACGCTGAAGTAGATTTCACGAAATCTGACGGGATAAGGCAAGCCAGACAGGAGATCAGAGAACCAACGAACACATCTGTGTAA

Transcript

OS493_002362-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6P4Y6	Insulin receptor substrate 1 OS=Xenopus tropicalis OX=8364 GN=irs1 PE=2 SV=1
P84770	Insulin receptor substrate 1-B OS=Xenopus laevis OX=8355 GN=irs1-b PE=2 SV=1
P35569	Insulin receptor substrate 1 OS=Mus musculus OX=10090 GN=Irs1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007882 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02174 all species →	IRS	PTB domain (IRS-1 type)	Domain	Interproscan
PF00169 all species →	PH	PH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002404 all species →	Domain	IRS-type PTB domain	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR039011 all species →	Family	Insulin receptor substrate	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10614 all species →	INSULIN RECEPTOR SUBSTRATE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005158 all species →	Molecular Function	insulin receptor binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008286 all species →	Biological Process	insulin receptor signaling pathway	Interproscan
GO:0043548 all species →	Molecular Function	phosphatidylinositol 3-kinase binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002362-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002362-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

10.6Max TPM

5.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.27	6.93
polyp at pH7 6	18	18	5.33	8.41
coral polyp · control treatment	16	16	6.53	10.06
coral polyp · oil and dispersant treatment	16	16	5.40	10.64
coral polyp · oil treatment	16	16	5.80	8.99
coral polyp · dispersant treatment	16	16	4.15	7.94
Polyp	10	10	3.22	5.61

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.51
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.07
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.98
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.60
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.52
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.03
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.75
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.63
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.07
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.92
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.51
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.19
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.03
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.95
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.88
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.86
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.82
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.93
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.86
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.02
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.10
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.04
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.76
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.92
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.55
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.93
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.89
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.64
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.70
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.51
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.46
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.19
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.84
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.75
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.35
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.14
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.00
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.88
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.63
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.18
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.71
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.35
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.48
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.36
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.47
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.45
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.42
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.82
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.78
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.74
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.94
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.60
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.97
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.92
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.83
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.48
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.81
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.72
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.61
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.60
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.41
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.05
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.36
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.54
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.52

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.