Gene detail

Detailed information of OS493_002366-T1 in Lophelia pertusa

Genomic Location: scaffold_5:1142770...1161112
NR annotation: KAJ7365654.1, Glycine--tRNA ligase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002366-T1

ATGGACAGCCGAAAAATTACACACCACTACAACAGAGCTGGTGACTTGGTAAAAAAGCTAAAATCCGAAAATGCTCCAGCACCTGATGTTGAAGTGGCCATCAAAGAGCTTAAAGTCAGGAAAAAGGCTCTTGAGAACAAGGAGAAAGAACTAGCCCCCAAACAAGAGAAGTTTGACAGATCAAAAATGGAGGACTTGTTGAAAAGACGCTTCTTTTTTGTCCCTTCCTTTGAAATATATGGAGGTGTGGCAGGCTTGTATGATTATGGACCATCTGGCTGTGCTATGGAGGCCAACATGGTCAACATATGGAAATCACACTTTGTTCTGGAAGAGCAAATGTTAGAAATCAGGGCATCACTGCTTACACCTCATCAAGTTCTCAAAGCATCTGGCCATGTAGATAGGTTTGCTGATTACATGGTAAAGGATGTCAAGAGCGGTGACTGTTATCGAGCTGATCATCTATTAGAAGGTCACCTTGAAAAGTTATTAGCTGATAAAAAACTGGATGAAGGATTGAAAAAGGAATATGAAAGTGTTATTGGTCAGATTGACAACTATGGAATGAAACAACTGGGCGAGCTACTAAAAAAATATAATGCTAAGTCACCGGTGACAGGAAATGACTTGACTGATCCTGTAGAGTTCAATTTGATGTTCACAACCTCAATTGGTCCCAGTGGGCTCATCCCTGGTTATCTTAGACCAGAAACAGCCCAAGGTATCTTTGTTAATTTCAAGCGACTCTTGGAAGCTAATAATGGAAGGCTGCCATTTGCTGCTGCTCAGATTGGACCTGCCTTTAGAAATGAGATCTCGCCCCGAGCAGGACTTCTAAGAGTAAGAGAATTCACATTAGCTGAAATTGAACACTTTGTTGATCCATGTGACAAAAGTCATCCCAAGTTTGAGAATGTCAGTTCTCAAACAGTAACACTGTATCCTGCGGAACATCAGATTGAAGGACAACCCGCTGTTCACATCGCTTTAGGGGATGCAGTCAATAAGAAAATCGTTAATTCCCAGACCATGGGGTACTTTCTTGGCCGAGTGTACCAGTTCCTGTTGAAGGTTGGGGCCGACCCGAGTAAGATCCGCTTCAGACAGCACATGTTCAATGAGATGGCGCATTACGCCTGTGACTGCTGGGATGCAGAACTCCTCACCTCCTATGGCTGGATAGAATGTGTTGGATGTGCTGACAGGGCTTGCTATGACTTGGCCGTTCACTCGAAAGCAGCTGGGGAAAGATTAGTGGCCCAAGTTGATCTAGAACAACCTGAAATGATAGACGTGGTTGAAATAGTTCCAGAGAAGCCCGCCATTGGAAAAGCATTTAAAAAGGAAGGGAAAATTATAATGGAGCATCTGGCTCAGATGGATAAAGACAGTATCAAGGAATTCGAGGACAAACTGAATTCAAACGGCGAGGCGAGCATAACTGTAGATAACAAGGAATTTAACATTCAAAAGACCATGATCAGGGAAATCAAACGGTACAAGAAGGAAATTCACGTCCGTGACGTAGAGCCTCACGTGATCGAGCCATCTTTTGGAGTTGGTAGAATCATGTATGCTGTCCTGGAACACAACTTTAAAATCCGAGAAGGAGACGAGCAAAGAACGTGGTTGTCCCTTCCTCCAGCAGTCGCTCCCGTCAAGTGCTCTGTGCTGCCACTCAGCAAAAACAAAGAGTTTGCTCAATATGTCAAGAAACTTTCCGAGTGTCTCACAGAGCTGGATATTTCCCACAAAGTGGACGATTCGAGCGGTTCGATTGGCCGGCGTTACGCACGAACTGACGAGATAGCTATACCCTTCGGTATCACTGTGGACTTCGACACTGTTAACAAAGAACCTCACAGCGCCACTCTGAGAGAAAGAAACTCCACGCGACAAATACGCGCACAGATCGACGAGCTGCCCTCTATCGTTAGCAACCTTGTCCGCGGCAAAGTCACGTGGTCAGCAATAGAGACCAAATATGGTTTGTTCGAAGGACAGGAGACTGGCGCCAAGTAG

Transcript

OS493_002366-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P41250	Glycine--tRNA ligase OS=Homo sapiens OX=9606 GN=GARS1 PE=1 SV=3
Q5RBL1	Glycine--tRNA ligase OS=Pongo abelii OX=9601 GN=GARS1 PE=2 SV=1
Q9CZD3	Glycine--tRNA ligase OS=Mus musculus OX=10090 GN=Gars1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004597 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00587 all species →	tRNA-synt_2b	tRNA synthetase class II core domain (G, H, P, S and T)	Domain	Interproscan
PF03129 all species →	HGTP_anticodon	Anticodon binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027031 all species →	Family	Glycyl-tRNA synthetase/DNA polymerase subunit gamma-2	Interproscan
IPR002314 all species →	Domain	Aminoacyl-tRNA synthetase, class II (G/ P/ S/T)	Interproscan
IPR036621 all species →	Homologous_superfamily	Anticodon-binding domain superfamily	Interproscan
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR033731 all species →	Domain	Glycyl-tRNA synthetase-like core domain	Interproscan
IPR002315 all species →	Family	Glycyl-tRNA synthetase	Interproscan
IPR004154 all species →	Domain	Anticodon-binding	Interproscan
IPR000738 all species →	Domain	WHEP-TRS domain	Interproscan
IPR006195 all species →	Domain	Aminoacyl-tRNA synthetase, class II	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10745 all species →	GLYCYL-TRNA SYNTHETASE/DNA POLYMERASE SUBUNIT GAMMA-2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004820 all species →	Molecular Function	glycine-tRNA ligase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006426 all species →	Biological Process	glycyl-tRNA aminoacylation	Interproscan
GO:0070150 all species →	Biological Process	mitochondrial glycyl-tRNA aminoacylation	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01880	GARS, glyS1; glycyl-tRNA synthetase	EC:6.1.1.14	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002366-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

199.2Max TPM

33.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	31.25	48.74
polyp at pH7 6	18	18	32.92	64.60
coral polyp · control treatment	16	16	40.45	134.72
coral polyp · oil and dispersant treatment	16	16	27.80	72.69
coral polyp · oil treatment	16	16	37.82	94.55
coral polyp · dispersant treatment	16	16	24.83	92.50
Polyp	10	10	47.70	199.25

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.74
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.06
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.53
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.83
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.54
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.05
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.87
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.48
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.99
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.62
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.84
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.21
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.57
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.50
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	64.60
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.89
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.91
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.35
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.84
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.73
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.29
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.40
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.60
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.13
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.31
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.43
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.40
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.24
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	134.72
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.17
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.52
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.47
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.60
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.26
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.63
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.23
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.38
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.43
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.58
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.09
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.66
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.69
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.49
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.78
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.49
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.30
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.92
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.31
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.34
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.03
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.81
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.71
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.55
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.45
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.39
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.58
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	76.58
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.98
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.88
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.17
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.81
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.15
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.43
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.66
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.50
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.30
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.86
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.77
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.13
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.03
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.71
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.99
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.77
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.63
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.79
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.21
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	199.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	67.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	53.00
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	45.01
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	30.38
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	26.98
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	20.78
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	16.45
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	12.74
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.89

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.