Gene detail

Detailed information of OS493_002369-T1 in Lophelia pertusa

Genomic Location: scaffold_5:1200851...1211767
NR annotation: KAJ7365657.1, Glycine--tRNA ligase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002369-T1

ATGGAGAGGTGTCGTCATTCGCCCGGCATGCAGCCATTATTTGCACAGGATGTTGAACATCTAATCGACACCTGTGGAGTGCAGACTCCAAAGCAACTGCAAATGTCTTTCATGCTTTCCGCTTCATTTCACTCCGGGAGCCGGGCAGGATCGTTCACTGGCCCAAAAAGGCGCTTGAACGCAGAGGGTATGCTTGAATCAATGAACGACAACTCTCCACCAATTGCTGCCCACATGAAGTTGGGGAGCATATCTTTCAGCAAGGACGAAACTGGATTGTCAATGACAATGATTTACACATATGAGAAACAATATGCTACCAATCGTGCCCACCGGCGTCCATACCACTTCACACCATTAGAAGAGGGGTCACCATATGATCCAGCTAAACTTGGATTTTTGCTTCTGTCGGTAAGAGGTGCATTTGAACAAGACCCACTGACAGCTTATGCAGAGGACAATTTTGCTATCAAAGAAGAAGCCAAGTCATGGCCACTGCTATGCCAAGTCGACCAGTCTAGTGGAGCATCTGGCCACGTAGATAGGTTTGCTGATTACATGGTAAAGGATGTCAAGTGCGGTGACTGTTACCGAGCTGATCATCTATTAGAAGGTCACCTTGAAAAGTTATTAGCTGATAAAAAACTGGATGAAGGATTAAAAAAGGAATATGAAAGTGTTATTGGTCAGATTGACAACTATGGAATGAAAGAACTGGGCGAGCTACTAAAAAAGTATAATGCTAAGTCACCGGTGACAGGAAATGACTTGACTGATCCTGTAGAGTTCAATTTGATGTTCACAACCTCAATTGGTCCCAGTGGGCTCATCCCTGGTTATCTTAGACCAGAAACAGCCCAAGGTATCTTTGTTAATTTCAAGCGACTCTTGGAAGCTAATAATGGAAGGCTGCCATTTGCTGCTGCTCAGATTGGACCTGCCTTTAGAAATGAGATCTCGCCCCGAGCAGGACTTCTAAGAGTAAGAGAATTCACACTAGCTGAAATTGAACACTTTGTTGATCCATGTGACAAAAGCCATCCCAAGTTTGAGAATGTCAGTTCTCAAACAGTAACACTGTATCCTGCGGAACATCAGATTGAAGGACAACCCGCTGTTCACATCGCTTTAGGGGATGCAGTCAATAAGAAAATCGTTAATTCCCAGACCATGGGGTACTTTCTTGGCCGAGTGTACCAGTTCCTGTTGAAGGTTGGGGCCGACCCGAGTAAGATCCGCTTCAGACAGCACATGTTCAATGAGATGGCGCATTATGCCTGTGACTGCTGGGATGCAGAACTCCTCACCTCCTATGGCTGGATAGAATGTGTTGGCTGTGCTGACAGGGCTTGCTATGACTTGGCCGTTCACTCGAAAGCAGCTGGGGAAAGATTAGTGGCCCAAGTTGATCTAGAACAACCTGAAATGATAGACGTGGTTGAAATAGTTCCAGAGAAGCCCGCCATTGGAAAAGCATTTAAAAAGGAAGGGAAAATTATAATGGAGTATCTGGCTCAGATGGATAAAGACAGCATCAAGGAATTCGAGGACAAACTGAATTCCAACGGCGAGGCGAGCATAACTGTAGATAACAAGGAATTTAACATTCAAAAGACCATGATCAGGGAAATCAAACGATACAAGAAGGAAATTCACGTCCGTGACGTAGAGCCTCACGTGATCGAGCCATCTTTTGGAGTTGGTAGAATCATGTATGCTGTCCTGGAACACAACTTTAAAATCCGAGAAGGAGACGAGCAAAGAACGTGGTTGTCCCTTCCTCCAGCAGTCGCTCCCGTCAAGTGCTCTGTGCTGCCACTCAGCAAAAACAAAGAGTTTGCTCAATTTGTCAAGAAACTTTCCGAGTGTCTCACAGAGCTGGATATTTCCCACAAAGTGGACGATTCGAGCGGTTCGATTGGCCGGCGTTACGCACGAACTGACGAGATAGCTATACCCTTCGGTATCACTGTGGACTTCGACACTGTTAACAAAGAACCTCACAGCGCCACTCTGAGAGAAAGAAACTCCACGCGACAAATACGCGCACAGATCGACGAGCTGCCCTCTATCGTTAGCAACCTTGTCCGCGGCAAAGTCACGTGGTCAGAAATAGAGGCCAAATATGGTCTGTTCGAAGGACAGGAGACTGGCGCCAAGTAG

Transcript

OS493_002369-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P41250	Glycine--tRNA ligase OS=Homo sapiens OX=9606 GN=GARS1 PE=1 SV=3
Q5RBL1	Glycine--tRNA ligase OS=Pongo abelii OX=9601 GN=GARS1 PE=2 SV=1
Q9CZD3	Glycine--tRNA ligase OS=Mus musculus OX=10090 GN=Gars1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004597 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00587 all species →	tRNA-synt_2b	tRNA synthetase class II core domain (G, H, P, S and T)	Domain	Interproscan
PF03129 all species →	HGTP_anticodon	Anticodon binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR027031 all species →	Family	Glycyl-tRNA synthetase/DNA polymerase subunit gamma-2	Interproscan
IPR002314 all species →	Domain	Aminoacyl-tRNA synthetase, class II (G/ P/ S/T)	Interproscan
IPR004154 all species →	Domain	Anticodon-binding	Interproscan
IPR033731 all species →	Domain	Glycyl-tRNA synthetase-like core domain	Interproscan
IPR006195 all species →	Domain	Aminoacyl-tRNA synthetase, class II	Interproscan
IPR036621 all species →	Homologous_superfamily	Anticodon-binding domain superfamily	Interproscan
IPR002315 all species →	Family	Glycyl-tRNA synthetase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10745 all species →	GLYCYL-TRNA SYNTHETASE/DNA POLYMERASE SUBUNIT GAMMA-2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004820 all species →	Molecular Function	glycine-tRNA ligase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006426 all species →	Biological Process	glycyl-tRNA aminoacylation	Interproscan
GO:0070150 all species →	Biological Process	mitochondrial glycyl-tRNA aminoacylation	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01880	GARS, glyS1; glycyl-tRNA synthetase	EC:6.1.1.14	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002369-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

153.6Max TPM

22.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	22.51	31.47
polyp at pH7 6	18	18	22.36	42.33
coral polyp · control treatment	16	16	25.63	90.87
coral polyp · oil and dispersant treatment	16	16	15.69	49.14
coral polyp · oil treatment	16	16	24.12	72.80
coral polyp · dispersant treatment	16	16	15.44	70.62
Polyp	10	10	35.29	153.55

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.47
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.39
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.27
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.02
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.41
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.04
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.83
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.81
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.27
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.12
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.30
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.69
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.26
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.67
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.33
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.26
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.43
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.24
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.23
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.58
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.81
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.89
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.01
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.64
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.34
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.89
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.03
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.58
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.24
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.08
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.93
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.88
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.78
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.86
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.50
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.16
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.20
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.47
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.73
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.06
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.80
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.56
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.56
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.73
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.72
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.58
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.78
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.03
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.68
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.70
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.58
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.17
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.16
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.28
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.48
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.28
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.53
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.71
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.61
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.10
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.96
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.06
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.52
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.02
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.35
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	153.55
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	41.80
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	34.08
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	29.91
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	26.32
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	19.91
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	19.88
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.19
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.70

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.