Gene detail

Detailed information of OS493_002399-T1 in Lophelia pertusa

Genomic Location: scaffold_5:1666201...1684746
NR annotation: KAJ7365684.1, semaphorin domain, partial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002399-T1

GCTGAATTTGTCTCGTCATTTGATCACACTGACAACTTTGTTTACTTTTTTCTGAGAGAGACTGCTATAGAGACGAGTAAGACTATTTATTCAAGAGTGGCCAGAGTTTGTCAGTACGATGAAGGAGCTCAAAGACGTCTGAAAAATAAATTCACTTCATTTGTGAAGACTAGAATATTATGTTCTATCCCTGGGAAAATACCATTTGATTACAATGAAATACAAGCAACTTTTACCTACACTGATCCTATAACAAATGAACACTATGTCTATGGAATTTTCACCACCCCAGAGCTTGGATTGCTTGGCTCAGCTGTTTGTATGTACAGTATGAAGTCTGTTCAGGAATTGTTTGCTAAGAGCCAGTACTTGAAAGATACTACCAACAAAGGGTTTGATGGCACTTCATTGTGGGTTCCTGTATCTCCTCCAGTAAATTTAACAATGGTTCCTGGCAGGCCAAAGTGCGATGACAAACTTGATACCAAGAGTTACTCTTGGGAAACCATCAAGTTTGCTTCTGAGCATACTCTGATGGCTGATCCACTTGAGCCACAACTACTGTCTCAAGCAAGAAAACCTCTGTTTACCAGAGATGAAACAAGATTTACTCAGCTTGTGGTGGATAAAGTTAACAGAGGAAATGGACAGTTTATACCTGTCATGTTTATTTCCACAGACAATGGCACAGTGTTCAAAGTTTTTAACAACATATCTGGTGATAACAGCCCTATTATTGTGGAGCAGATCAAAGTTTCTGAGAAACCGGATCCTATCAATACAATGAAACTTTATAAGGGAGCTGTGTATATTGGAAGCAATTCTAGTGTTGTCAAGCTGCCAGTGGAGCACTGTAGTCAGTACCAGATCTGCAGGACTTGTATTTCCATTGTGGATCCCTACTGTGGTTGGAGTAACAACAAGTGCACAACATTTGAAAACAAGAAAGGAAGTGACTGGGCTCAAGACATTGTTCATGGCAACTTTTCTAAAGTTTGTCCACAAGTGCCTCCAACATGTTCGTTGACAGTTACTCAGGAACAGGTGGGAGGTGTCAGCAGTTTGAGCTGCGAAGGAGATGGAATCCCGCTTCCTGAAGTGACCAAATGGGAAAAGGATTCCAAACCACTTCCTGTTGACTCAGACTTCCAGATCAAACCCGGCAAGACAGGTCATCAGGAACGCTTGGACATCTACAACTTTGGAATGGGACATCTTGGAGTTTATGAGTGTTTCGTGTCTAATGAACTGGGGTCGTCTTCATGTGCCATGAATATCAGAGGTACATTGCCTGTTGCCACGTATACCATTGTGAAAATCAATGGTACATCTTCGTTTGCGTGTAATGCCACTGGCCTGCCCAGTCCACGCGTAACTATCTACAAAGTAATCAGGGACACTAAACATGTGATTATGGCACGCCAAACATCCATCAATAATGACACAGGTCAGAGGTCGTACTACTGTGTGGCACAGAACGACTTTGGAGTATCATTCAGCAAACAGGTCAACATCAACGATAAACAAGTCAAAGCTGAGTTGAGGCTTACAAATGAACAGTGGAGTGCAGAGCTTTACAATAAAAAGTCAGAAAAATACAAAACCCTGGCAGGACAAGTCAAAACTGTGGTGCAAAAAATCTATGCTGAAAACCCTGCCTTTATGAGTTTCAAGGTTATTTCATTCAGTAAAGGAAGTGTAATATGTAAAATGACTCTGAACTTCGCGGCTGAACCTTTGAACAAGAATGAGGACCTATTGAAGGATTTACAAGATAAGGTGGCATCTGGTAAAGTGGGACACTTCAGCGTGGATCAAGCTCATACTCTTAATGTGGAGCCTGATGTTGAAATAACAACCACCCCACAGCCCACCCAACCGGTTTTTAGTACCGTTCTGGTGACCTTGACCAATGGTAGTACCCAATCCTCTCAAAAGACAGAACCTACTCCAGCACCAGACGTACAAAATGATTTGATGGACAGTGGCTTGTTTGCAGTGGCTGTAGTGACGGCTGTGTTGTTAAGTCTTATGTTAGGGATTGCACTGGGAGTGATATTTTACGGTCAGTTTATGCACCGCTGTACACGGTCATCTGGAGATCCAGAATCGTGTGATGGGCCAACCAACAGAACTATTGAAGGTGTTAAGTATACCAAATCACCTCCCAGAGATGAGAGTTTCACGAGGAACAAGAACGAAACACAGAGCAAGAGAAATCTGCTAAAAAAGAAAGGAAAAAACACTGAGAAAACAGAAGATAGTGATAGTGATTCCTCTACTGCTGGTAAGATTGGAGAAGAACAAGGTGCAAACCGCAAAAATAGCAGCAGTACATCAAACTCACCTACAAAGTCCATCTCGCCAACTGTTTCTATCGGCAAAAAAACCATCCCTGAAAAATGGGAAAATACCGAACGCGTGTTAGATGGAAAATATGAAATGGCATGCAATGCCGACAAGAGAGGGGACTAG

Transcript

OS493_002399-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q90665	Semaphorin-4D (Fragment) OS=Gallus gallus OX=9031 GN=SEMA4D PE=2 SV=1
Q24322	Semaphorin-1A OS=Drosophila melanogaster OX=7227 GN=Sema1a PE=1 SV=3
Q26473	Semaphorin-1A OS=Schistocerca americana OX=7009 GN=SEMA-1A PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002518 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07679 all species →	I-set	Immunoglobulin I-set domain	Domain	Interproscan
PF01437 all species →	PSI	Plexin repeat	Family	Interproscan
PF01390 all species →	SEA	SEA domain	Family	Interproscan
PF01403 all species →	Sema	Sema domain	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR001627 all species →	Domain	Sema domain	Interproscan
IPR036364 all species →	Homologous_superfamily	SEA domain superfamily	Interproscan
IPR027231 all species →	Family	Semaphorin	Interproscan
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR013098 all species →	Domain	Immunoglobulin I-set	Interproscan
IPR002165 all species →	Repeat	Plexin repeat	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR000082 all species →	Domain	SEA domain	Interproscan
IPR036352 all species →	Homologous_superfamily	Sema domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR016201 all species →	Domain	PSI domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11036 all species →	SEMAPHORIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0001755 all species →	Biological Process	neural crest cell migration	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007411 all species →	Biological Process	axon guidance	Interproscan
GO:0030215 all species →	Molecular Function	semaphorin receptor binding	Interproscan
GO:0030335 all species →	Biological Process	positive regulation of cell migration	Interproscan
GO:0045499 all species →	Molecular Function	chemorepellent activity	Interproscan
GO:0048843 all species →	Biological Process	negative regulation of axon extension involved in axon guidance	Interproscan
GO:0050919 all species →	Biological Process	negative chemotaxis	Interproscan
GO:0071526 all species →	Biological Process	semaphorin-plexin signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002399-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002399-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

128.6Max TPM

46.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	46.00	93.15
polyp at pH7 6	18	18	43.95	79.65
coral polyp · control treatment	16	16	45.37	85.83
coral polyp · oil and dispersant treatment	16	16	69.48	128.64
coral polyp · oil treatment	16	16	52.02	78.86
coral polyp · dispersant treatment	16	16	36.39	95.19
Polyp	10	10	22.01	45.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	93.15
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	86.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	83.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	81.39
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	60.27
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.95
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.92
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.96
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.93
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.35
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.98
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.19
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.21
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.02
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.53
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.28
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	79.65
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	78.74
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	66.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.44
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	52.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.67
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.35
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.72
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.60
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.65
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.56
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.60
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.26
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.24
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.83
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	78.40
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	66.68
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.11
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.09
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.80
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.50
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.15
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.02
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.54
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.13
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.38
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.77
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.64
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	109.85
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	109.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.39
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	88.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	85.79
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.83
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	61.34
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.31
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.28
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.66
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.26
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.86
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	72.38
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	63.11
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.24
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.28
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.50
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.81
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.32
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.81
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.32
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	95.19
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	73.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.33
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.33
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.74
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.69
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.52
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.63
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.78
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.63
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.63
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.23
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	45.16
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	41.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	30.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	26.38
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	19.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	17.72
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	13.83
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	8.50
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.52

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.