Gene detail

Detailed information of OS493_002436-T1 in Lophelia pertusa

Genomic Location: scaffold_5:2219534...2232640
NR annotation: KAJ7365720.1, hypothetical protein OS493_002436 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002436-T1

ATGAACCGGCTTCAGAATCTCACACTAGTTAGCTCTGACCTCCAAACAAGGGTTGCTGCTTCCAGAGATGAGAGTGAAGTTCTTCTTAACAGTACTTTAGAAAGAGATGCTAACTTACCAGGACTTCGCACCAATGTTACCTCGTCAAGCCAGGCGTACAGGAATGCTGTGATGACTGGGACATCAGTTGATGCCGATTACAGCTCGTTACAGTCCAGTAGAGACTCACTGGTTCAAGCTGCAGAAGTAGGAAGCAGCCCTCACTCTATCGTGTCTGATGCCCAGACTGCTAGTGATTCTGTTAACGAGGCAAGATTTCGTTATGAGCCAGTGAACACTGGAGTACCGGCTCTACTGGATCAAGTGAACAGACTGGAGCAGAGGATGCAATCCATTAACCAATCAGCAGAGAGGGCTGGGGTGTTGATGAACCAGGCATTTGATAATGTGGAAAATGCGAGTAGATCATTGGGTAGTGTGGATAACAAGGTACAAGAAGCTGATAGACTCAAGAATGTAACAGTGAACTTACAAGCCCAACTGAAACAAAATATGTCAGTACTGGAGGAAAAGCTGAGGAGAGCCAGAGAATATGTTGCCAAGATTCGTCTTGCTCTGAACGTTCAAGGACGTACAACTGTGCAGTACAGCCCAACAGCCCGCTTGATAAACAACACCAAGTACACTGAAATAAGAGTGGATTTCAGGGCTACACGCGTACAGGGCTCGCTTATTTACTTGTCTGATGGGTCCAGTAGCGCGGCTCGAAGCGTGGCTCTGACTCTAGAGAGTGGATTGTATGTGAAGTTCCAGTACAACCTTGGTACAGGACCTATTACCATCACCAACTGGGCAGTGCGAGTACGGCCTGGGTACTGGTATACAGCGTACGCCACACGCTATGAGAAGGAAGGACGGTTGACAGTGACAGATCACAGTAGAAATTTCAGCCGCACATACGAGGGTACCACGGACATAATACCTGCGTACCTGTCCACGGACTTCAGCATTGATGATCACATTCATGTTGGAGGTCTGCCTGATGGAGTTATGATAAACAAGACTGACCGGTATTTTGATGGCTGCATCGATAACATTGTGTTCAACCAGGAGGCCCTAAATATTTGGAACCCAGTCGAGGTGGACGGAAATCGATCATTCTGCTCCAGAAGGCCTGCTGTCCAGGTAGACGTAGTTCCAGGATCCAGTTTCTATGGTATTCCAGAAGGACACGTGAAGCACCAGATGGGAGAGTTCAACATAACTGGCGAGTCACAGATGATGTTTGAGTTCAGAACATTCCACAAAATGGCTTTCATTACAAGTGTCTTGAACGGACAGGACTATGTATATGGAGTATACCTGAATGACAGCAGAGTGGCGTTCTATTTTAAAACACCCAATCAAACATATACTGTACATAGCAACGGAAACTCGTACAGTGATGGACGCTGGTACAGAGTGCACGTGGTGCGAGGTCTGAGGAACGCCAGTCTGACGGTCAGACCTGTGGGTCCGTCAGACAGTGGTGCAGTTGATTACAGCACGATAATGACACCCACACCTGTGTATCTTCCTGATGGACAGTGGCTGTTCTTCGGTGGCCAAGATCCCAACAGTGTAATTAGTGGTCCTGTCAGCGCTTCATATGCTGGGGCTCTAAGAAATATCAGCATTACTAGTTATTCGTCTGGATTCCTTGTGGAGCGGCAACTTGACAGCGCAAACTTTACCCAGTCATCAAAGGGTGTGAGCTTCTCTGGATTGCTACCAAGGGTGGAGAAAGGTATTCGATTCCTTGGTAACAGTTACGCTGCTGCGGAAACAGGTCAAGCACAAATGGTGTCACTACAAGTCACCTTCAAAACATTGTCTCCCAGTGGTGTTCTAGTTTATAGTGGAGAGGGTCCTGTCTTCTATCTGGCTCTTTTCCATGGCAATCTTTATTTAGTATACGCCGAAGATCTGAGTATGTTCGTTCCCATTGTAAGCCAAGATGAGACACTTAATGATGGCGCCTACCATACTGTGAGAATTGAATTTGGTGCAGTTGGGAGCAACGTAATCCTTGATGGTAATGTCTTGCCAACACCTGGTGATGGGTTCGCAACGGGCCCAGTTCGCCTCAATGGTAGTTTGTGGATAGGAGGTGTGGATGATAGAACAGCCATACCCAGGGATCTTCCTGTTATCGATGCATTCGTTGGAGGCATGAATATCCTGGAAGTAAACGGACAAGCTGTGAACATCTTCTCAGGACGAAGCCAGCATGTGTCGTTAGCAGGAGTATCACCTGAACTGAACGTCGTACCAACGGCCCTTCCTACCACCCCGCCCCCACACTACCACCTCCCACTTGTGGTCGCCCGTATCCACCCCTGCGGAATACATCAAGAGAAGACGAAGCTCGCTTGGAAGGCTCTGATTATATCGCCTTCTCTTCAAGTTCGGAAGTATTAA

Transcript

OS493_002436-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001117 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06009 all species →	Laminin_II	Laminin Domain II	Coiled-coil	Interproscan
PF02210 all species →	Laminin_G_2	Laminin G domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001791 all species →	Domain	Laminin G domain	Interproscan
IPR010307 all species →	Domain	Laminin domain II	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR050372 all species →	Family	Neurexin-related cell adhesion and synaptic protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15036 all species →	PIKACHURIN-LIKE PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007155 all species →	Biological Process	cell adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002436-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002436-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

89.4Max TPM

27.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.97	32.65
polyp at pH7 6	18	18	17.82	25.56
coral polyp · control treatment	16	16	32.36	79.40
coral polyp · oil and dispersant treatment	16	16	36.66	49.16
coral polyp · oil treatment	16	16	28.33	43.24
coral polyp · dispersant treatment	16	16	44.63	89.44
Polyp	10	10	9.23	18.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.65
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.86
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.52
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.44
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.28
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.84
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.79
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.22
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.38
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.56
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.40
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.23
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.99
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.67
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.45
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.57
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.70
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.09
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.51
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.90
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.50
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.14
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.94
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.63
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.40
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.03
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.50
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.51
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.14
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.74
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.71
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.44
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.82
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.10
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.32
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.95
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.19
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.35
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.29
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.79
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.44
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.73
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.63
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.41
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.15
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.96
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.24
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.43
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.07
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	32.38
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.22
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.00
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.88
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.24
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.98
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.65
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.78
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.72
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.44
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	83.72
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.07
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.72
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.81
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.76
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.42
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.66
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.32
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.33
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.00
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.07
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.17
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.69
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	18.76
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.71
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.94
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.64
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.29
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.09
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.22
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.07

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.