Gene detail

Detailed information of OS493_002568-T1 in Lophelia pertusa

Genomic Location: scaffold_5:4616224...4636273
NR annotation: KAJ7365847.1, hypothetical protein OS493_002568 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002568-T1

ATGTCAGATGAAGCTTCTCGAGAAACTTGCCGGCAAATTGTTTTTCTCATCGACTTGAATCCTTCGTTTTGGGGATCCAACTACTGCGCCAAAGACACAGCGAACGCCATTCGATTATGCGTGCTAAGAGTCCTCACGTACTTCAGTGATTACGGCAGTGGAAAGAGATCAAATCTACGATGGGGATACAAATTCTTCAACTCCAGGTCACTTTCACATCAATTTGAACGACATGAGTTCAAAGAATTCTCTGTAGATGTCTTTGAAGAATTTGAAAATCAGGTGTCCAAGAGTTCACGATTTTCAGTGGAGAGACCAGACATAAGTTCGCCAGTAAGAAGAACTCGGGGAAATGAAAACTCGCTTCATGGCAACGGAACAAAGACACGAAATGTTATGATTTTGTTGAGTGGTTGTCCTTGCGACGATGGCTCGATCTCAGACTTTACTGGTGAAAAATCATCATCTCTAACAACGCTGGATGGTGTCAAGAATATTCTGATGCCATCAGTGTTGTACAATGAATTTAAAGAAAGACGCATTTGTTTGCAGTGGGTAAACATTGGAAATGTCCAACACGAGAAGAATACCAGCTTGAAATCATTATTGGATGGTTTTGTGGAACAGCTTGGAGGATGCCTGATGCCTCTTTCAGCAGTCATTAATACTGGAAATATTTTCTCAGAGGGGTTTGGTGTAACAAGTGGATCTGGAACAGATGTCACATCCTGTTCTAGTCATGGAGCATTATTTCCTTTTAAAACTGTCATGGATTTCTATTTCTGTGGAAAGATGACAAAGCTATCAGAAGTAGTCACACAACAGTACTTTGAAAAGGAGCTGGGGTGTTCTGAGACCACAGGATTACTGTGTTCTTCAGGTACTGATGACAAAGTTCATTGTTCTGTAAGACTACATTCCATGTTCCAGCCAGTGGCAGGACTGCAAGGCGCAGGAGATTGTCATCATTCCACTGTTACTGAACCTGCCGATATAACAGCCAAAGCTTCAACATCAACTGAATACAGAAGCTCTCCTAATCCTCTGTGGATCAGAGGAGTAATAAATCATGCTTGTGTGTGTCCAACATGGTTACACCCCACAAAGGGATACTCTTGCATTGGCATGGATGGCAGACATACAGTTGATTCAACAAACTCTGCTTTGTGTTCTCACGGGTTTATTTCTGGCTGGTTCCAAGAACTCTTACTTTCCTTGGCAAAAGACAACAAACTTCTGGTTCTTGATTTCATTGACTGTGATAGTGGATTACCAGTTAGTGGAGTCCTTCAGCCCTTGACCTCTGTCTGTGGTGTCATAAATGTTATTGCATCAGATTTTCTTGTGACGTTTGAAAAGCTACTTCTTTGGAACGGAAAGACTTCAGTGCTGGATAGGAAAAATATGGAAAGTCTGGAAACCTCCCAGCATTTGGTCCATGAGCACAGATCCAAAACTGTTTCTAAACCAGCTGAACCACTTAGATACAATGAAGTATTTCTCAAGCTTACAGGATCACAGAATAACCTGCAAGATCTGACAACAACTGATGCAAGGGAATTTGAAGCTGGGTTTGTTGATCCATGGTGCTCTTTTCCTGTTGTTGATAACAACAGGTCACTCTGGAGTGAACTGACAAGAGGTAATGAGTCTGAAGAAGAGGAAGAAGATGATGATGACAGTGAAGCTACTCTAATGAAAGAACTGAAGAATCTTTATAACAGTAAAGAAACAAAGTCAACATCAACAGTTGTTAATGGAACACAATCACCAAAACAGTTTAAAGAGGAAGTTAAACACTCCAACGAAATCAAAGGTGAAAAAGGATGCATTGAAGCTGAGATCTTGTTACAAATTCCTAAGAAGCCGGGTTCAAGGTCTCTTCAAAGTCTTGGCAGTGGTAGAAATGTTGACAAGGAAACAAAAAATGATGATGAAAACAGCAAATTGGGTGAAAATGAAAGCCAACCTGCAGTTGAGAAGAATATAAAAATAATAGAAGATAGTTGTACCACAGAAGACAAGCTGACAGCCAATAGCACTGGAACACAAGGCATCCCATGTGATATCCAAGATGAAGCTCAGTTGGTGAAGGACATTCATGATTTATGTGACAAAATTATTTTGGAGGGAGCAAGTATAGAAATCACCAACATAGTGACACTAATTTCAATGTTTTATAATGGAGACAATGGCAGACAGAAGGATTGTGTTTCACAGTTTCTAGGAGAGAATGTACTCCTGTCAATATCAACACTTAGAGAAAAATATGAAGGGTGCAATGATGTCATCAGAACAGGACAACAAGTCAGAGAGTACCAGCTCCAAATCCTACTTCGAATGGAGATGTCAGTTCTTACAAATGCTGATGAAAAAAGTTCCCTTGTTGAAGAGGTGACTGTACTGTTACGAGCCATCTCATTCATGAAGGACCCTAAGTTCCTCAGTGTTTATCTACACGAGGTACTTCTTCAAAGGTACAGCCGCAGTCTTCCCAAGTTCCTGTGTGGTGTTTATGAGGGTCTGATGATGCGTCCTCCCAGGGATGTGTTGACACCCTCCAAATGGTCCAGTGATGATGAGTCGCCAGTCAGACGCTCTGTCAACTCGAATTCCAGCGCTAAACAAGATTCCAGTCAACCAAGGAGCAGTGGATGCCGTATTCTTACCCGCCATTTGAGTGTCGCAGATGTTGGTAAAAGAAGAGAGATCGTTGTACCTGGGAAGGCAAAACCAAAAGATAAAGAGAAGAAAAAGAAGGAAAAACCACATGGGTCCAATAATTCACGAGGTGTAAACAAGAAGGAGGAGAAGAAAACTAGAGGCCAGAAAACACCTGTTAAACTAGTCAGACGAAATCTGTTCACGGAATCTGAGGAAGAGGGAGGGAAAAACGAGCAAGCTAGACGACGATTTCACCGGAGGAATACTGTGGGGTCTTTTTCAAAATCCGCTGTTCAAGAGACTCCGGCTCATAAACAAGTATCTCATGCATTGTGGTGTAAACAAGATCGTGCAAGGAAACGTTCCAGTGCTTATACTGCAGAGGTGCCTGTTTTACAGGAGTCACCCTTAAAAGAGTTACAAGCAGGAGAGGGTCTTCCTCGAAGAAGTCCTCGGAGGCACCCAGCGGTGATCTTCCAGCGGAGCCAGTCATTTTATGGGCGCTCGGCGAGTGCAGGCCCACTGACCAGGACCAGGTCCTTCACTGGGACGTATTCTTGTGACTCCCCAAAGAAAGAGCCCACCGAGGGATCGGGTTCCATTCCCTGTAAAGAGACCGTTGTTAAGAAGACGCCTCAGAAGATGTCGTCTGCTGCTCTCTCGCCGTTGCGGTTCTCTCCTCGGCACAAGAAGAAGTTTTCTCTGCACAGTTTGTTGAACACAGCAAAAGGATTCGATCAAAAGGAAGACAGTTTGCCAAGTGGTCAGAGACCGACGACACCTAAAGAAAAGCTTATCGCTACAAGGTCTTCTCCAAGACTTCTTAAACAGCGCTCTTTTTCTTGCATTGGATTTTCGTCTGTTCCTTTTCCTGGAGTTCAGAAAGAGAAGTTAGATCCTCTTCGTGGAAAGCCCAGATCATTTGAAAATACAAGCCGCCAGTCACCAGTAGAGGAGGAAGTTTGCTCAGATGATGTTTTACATGAAGATTTGATGAAAACACAGAAGAAAGAGAACGCAGAAAAGCTTTCAGACGTCGGAGTGATCACTCCAAAATCTACTATTGCGCAGTCACAAAAACGAACTCCATTGAAAGATTATCAAATCGACGAATGTGTCGTTCTTATCACGCCAATTCGAAATCCCTTGAAGTCACCCGTGCAGGTTTCTCCGAAGGTTATAGCAGCAGACCCTTCTTCAGACCACGCCCAACCACGTGTTATTGACTCATCAAAACATTTCGACGAATCTGCAGGAGTGTCCGATGCAAACACAGGAACGCCTGTAAAGAAAGTGGTCAGTCCTCCAGCTGTTCGCAGCTCGCCAAGGTTACTCAGCAAATGGGACATTCCAGACTCTTCCAAAGTAACATTGAGCGACACTTTGTGTCAATCTACATCGAAGGATGTAAAGATTACGAAGTCTAGCTCTGTAGTCTCTCCAAAGTCGAGCAGGGATGATCTGAGAAAGCCCAGAACTCCAGTTAAGGATCATCATCTGGACGACTTTGTGGTACTTCTCACTCCCATCAGGAGGCCTATATCATCACCAGTACACCTGCGATCACAACAAAACAACGCGATAGTCACTTGTTCGGATTCCGAAAGCACTGTACAACTAAACGGCGTAATATCTCAACAGCAACGGAAGGAACGGAAAGAATCGCTGACTTGCATGGAGATGTGA

Transcript

OS493_002568-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DRL4	Treslin OS=Danio rerio OX=7955 GN=ticrr PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004353 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15292 all species →	Treslin_N	Treslin N-terminus	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032746 all species →	Domain	Treslin, N-terminal	Interproscan
IPR026153 all species →	Family	Treslin	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21556 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003682 all species →	Molecular Function	chromatin binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0007095 all species →	Biological Process	mitotic G2 DNA damage checkpoint signaling	Interproscan
GO:0010212 all species →	Biological Process	response to ionizing radiation	Interproscan
GO:0030174 all species →	Biological Process	regulation of DNA-templated DNA replication initiation	Interproscan
GO:0033314 all species →	Biological Process	mitotic DNA replication checkpoint signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002568-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002568-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

34.1Max TPM

4.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.42	8.41
polyp at pH7 6	18	18	5.61	17.93
coral polyp · control treatment	16	16	4.44	34.09
coral polyp · oil and dispersant treatment	16	16	5.20	32.13
coral polyp · oil treatment	16	16	3.86	6.31
coral polyp · dispersant treatment	16	16	2.13	6.54
Polyp	10	10	2.22	5.14

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.77
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.80
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.35
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.17
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.01
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.80
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.75
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.36
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.16
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.93
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.55
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.69
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.58
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.89
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.11
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.96
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.70
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.39
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.22
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.73
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.33
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.09
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.07
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.07
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.64
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.81
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.37
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.10
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.03
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.97
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.63
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.38
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.91
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.13
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.65
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.88
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.84
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.97
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.75
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.38
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.99
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.90
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.31
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.08
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.17
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.65
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.54
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.26
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.94
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.56
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.93
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.54
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.69
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.54
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.59
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.16
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.69
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.36
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.95
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.36
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.14
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.80
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.55
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.43
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.95
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.90

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.