Gene detail

Detailed information of OS493_002573-T1 in Lophelia pertusa

Genomic Location: scaffold_5:4696089...4720691
NR annotation: KAJ7365852.1, B cell differentiation [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002573-T1

ATGCCGAAACCTTCCAATAGCAAGAAGCGGAAGAGGACGAACAAGAAAGGTGAAGATCACGACACGAAGAAAGTAAAATCGAAAGGAAACGATGTACAACTTGTGGAAGACGACTCGAATGTTTCCAATCTCCCTTATGAAGAACAACAAGAAATAGATGATATCGATGAAAAGTTGGAGCAAAATGCAGCAAGGAACAACTTAACGACAATTAACGTGAAGAGCATTTTGCACCATGTTGTATCAGACAAAAGAGTGCTTGCTATGGTGAAAAGTGTAGCTGCTGAATGCGATGATGAGCTGGGTGAAGCCACTTCAGACAATATGTTCGGAAACATGGATATGGAGCTTGATTTTGCACCTAAAATGACCAGAGCAAAGAGAAAACAGACAAATCAAGGAGATCCTATTGCTGTTTTGGCATCCCAGTCACCCATAAAAGAACGAAGAACAAAGCAGACCTCAAGCAAAAAAAAGATTAATTTCACAGAGTTAGAACTTCCAGATTCATCCTCTGATGAAGAATATAATCCAGATGAGGAAGAGTATGGTAGTGATGAAGATACAGAAAGTTGTGTATCCTTTACCAGTGACCTAGCCTCACCTCAATTTCCTGGCACACCAGAGAGTCAGAAGACAGATGATACAAAAGACTCAGAAGACACAACAAGCCACACTCAACCAGCAAAAACAGTGACACGATCGCTTAGCAAAAAGCTTTTGCAGGAGCCTTTTAAAGTTCCTTTTCCAGTGGCACCAACTACACCAACACCAGTTGATGAGATTACTGTATTGGAAGAAGGTGACTTGATAGCAAAGAGGACTCGCTCACAGCTGCCACTTGAAGATGTACCCATTGAAAGCATAGAAGCAACTTTCCAACCTCCAGACTTCACTGCGGACATGTATGACACAATCCAGGAAGATGATTTGGACTTTGAAGACATGGAATGGCAGAAATGGCTTCAGGGACTAATAAACTCAGATGATGTTTGTGGTGAAGAGGATCATGAGGACTCAGAATACAATTTTATGGCTGAAGATCAGAAGGAAGAAAAAGAGGAATACAGGAATGACAGGGCTGTTAGAATCCCACAGAAGGAAGTGAATGAGCTACTTGAGGAATTACTGAAAGATTATGATGAAAGTGAAGATGCATTATGTCTGGATGAGGAGAGTGAAGATATTAGCTACCTGGAGTTGCTAGATGGCAGGGCTGCAGTTGACGAAAAAGTGCAATTTTTCAACATTCAACAACTGGAGAGACTTACTGAGCAACTACAGCAGCATGCACAACTCTTGACGCAGATATTTGTGATGGCTCGGGAAGACGAGAGCCTGAGTAAAGAGGAAGAACTAACTCGAGACTATGTGAATGAACTGAAGGGTTTTCAGGACAGAGCGTCTAATGCTCAGCTGATCAGGGGGTTAGGTGATGGTATGGTGCACCCCTCAGCATTCAGCTTCCCAGGCCTGGAACAAGCTGTTGAAATCGTTAACAGAACCTTTGTTTCCAAGAGACGAACACCGAGCCCACGGAAATGTACCACACCTAAGAAAGATAGCAAACCTCCCGCTAAAACAGCCAGGCGTTCAAAAACTCTAACCGATGAACTACTTCCCACTCCCTCGGATACTAACATCCAAATAATGGCGACTTCCAAAGGCATTTTCCATTTTGTGGAGCTCCTTCCTCACCATAATCTGTTGCCAAGAACAGGCGACACACCCAAACAGCTCAACGGACTGAGGGTGAAATTCTCCGATGCTGAGGATAACCTTCTGGCGCTGGGAATGAAGCAACATGGTAAAAAGTGGGACTTGATACAGGAGCATCTTCTTCCCGTCAAGAGTCCCAAGCAGCTGCAGATTCGCTGCAAAAATCTGCTCTCTGCCCGCGCCCCCGAGAACATTATCAAGTACTACCGTAGGAATAGAGTGCTGTGGGAGTTACCCACTAGAATACAAGTCACGTTAGAATGCAATGGCCGTCGGTTGCTGCGAGGCAGAGATTCAATGGAGCCAGATTGGTTGGTAAAATACAACAAAAGACAAAAGGAGCGCCGTGAGAGTCAAGAGAAGAGCGAGGCTCTAGCTATTCAGCAAAGCATTGACAGCGCAGCGTATGGCCGACCAATCGCGCCTAAGTTCAGCGGCAGGGCCTGTACAGTGGCATTACCGAGTGGCTCGCCAGCTAGCAAGCGAGGAAATGTAGCATGGGTGGCTATAACAAGTACTGTAAGCCCATGGAAGCCTGTTACACCATCAAAGCCTGTTACACCATCGAAGCCGGTTGAAGATTCATGCGAACGAGAAAATACCTTGTGTGCAGGCAATGTGGCAAGTGCTCGAGCATCTCCTGTGGTTAGTGTTTGCCAAGAAAGTGCCTCTTTAGCAAACGAGGATCATGCGCCATTACATACCGCTCCCAGTGTAACAGCAGAAGCTGATGTGGATGTCAACATAACTCCCTCAATGGTAAACGATGAACCTCCAGTCCAGGTACAAGAAATGACTGAGAAAGAAACAAGTGTTCCTACTGCTGACGATGATTCTCCAAGTACCACTGTAAACCTAAAAGAAAATAGCAAAGAGAATGCTTTGAAGGACTCAACGGAAAAAACAGCTTCAGAGAGTTCAACCAACAAGAATGCTACATCCTCTAAAGCCAAGTCATCGCGTGACAAAAATGGAGGGAGCGTGACAGGTGGTCGTGTGACATCAAAATCACACATCTCTGGGTCTGAAAGTGGAGGAAATGTCAGCGGAACTTCCCGTAAGCCTGCACCAAACTCTCAAGCCGGCTGGTTGGGGAATTATATCCTGGAACCTGACCCAAAGTTCAGAAATCGAGCTCACGCATTTGCTGAAGGTTTTCTTGCTAAAGTCAAGAAACAGCTTATTGGTGACCCTGTAACATATGAAGAATTCCTGCGAACACTCGCTTTGTCTTCAGCAGAACAATGCTCGCCAGTTGAGTTGTACAGGAGGGTTGAAGTAGTTCTGGCTCAGTATCCTGGTCTTGTGGAGGATTTTGTAGGATTTTTAGAACCTCATCAGGCTGTAGAAGCAGGCGTGTTCATGGCAAACCTGGAGTTCGTGAGGGCGAGAACGTTTCTGAGGAAACTGGAGGTGCACTTCCAGCGGAGTCCCTCCCAATTCAGGAAGATAATCAACGCATTTGATTCTTGGAATAAGAAAACAGTAAAAGACCATTTGAAGTTACAGCAAACCATTGTTCCGATGTTAAAAGGACAACTGCACCTAATTGAAGAATTCTACTCATTCTTCGACGACTTGAAGCCTCCTGTGTGCTCTGACGATGATTTCGAGGAAGTTGAATTCGGAAGTGGGAGCGAACCGGAGGTTGATGATTTTGAAGAAGTAGTCATACCATGCTTCGTGGAGCCAAAGAAAATCAAAGGCAGACCTGCCAAGGACGCACTACAAAGAAACAATACAAGAAAGACTAGAAAGCCTTGTGTGAAAGGACCGAAACAACAAGGACCTGCAGGCAAACCGCTGGGGAACAAAACAAAAGGGGGGAGTGGAGTGGATGATCAGAGAACTGAGGTGAACGCACTGGAAGGACCTCTGTCCGTTACTACATCGCTGCAGTCGGAAACTAGCAACGACAGCTATCGCGGAGAGGAGTTAATACCCGCTAATCCGGCGGACACTTTAAACCTCGAACATGAAGAAGAACGCGAACGAAGAAACTCCGATAGCGAAGAACAAGAGGATGATGGGAATTCTGACATGGAGCATGATGGGTATGAAGAGGATGATGATGACGATTATATGGACGGTGATGATATAGACTGTGACGTCATCAAGAGTGACGCAGATGCTGAAGCCAGTGGCTGTGACAGTGACGCAAATGTTATTTCAACTGTTGTGCCAGCTAAAAATCTTCAACGGAGTCAAGATGGACAAGTGGTCCTTTTGTGGACGAGAGAGGATGACCGGGTAATATTACAAGCTTGCCAAAAGATGGGTGCCAAGCCAGAAACATTCCAACATGTAGCAAATGGCTTGAAAAATAAAACAGCAGACGAGATCAAAAAGCGTTTTATGGATCTTCTGAACCTTTTTAAAGCCAGTAGTGGTGAACGAACGAGAGAATCAACAAACGAGGATTCTTGCAGTGACGAGGAAGATGAAGAAGATAGTGAAACTATTGGTGAATCAGAAGGAGAGCAGCCCCACGACTAG

Transcript

OS493_002573-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3T8J9	GON-4-like protein OS=Homo sapiens OX=9606 GN=GON4L PE=1 SV=1
Q9DB00	GON-4-like protein OS=Mus musculus OX=10090 GN=Gon4l PE=1 SV=3
Q535K8	GON-4-like protein OS=Rattus norvegicus OX=10116 GN=Gon4l PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003296 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02671 all species →	PAH	Paired amphipathic helix repeat	Repeat	Interproscan
PF21227 all species →	Myb_DNA-binding_7	Myb-like DNA-binding domain	Domain	Interproscan
PF13921 all species →	Myb_DNA-bind_6	Myb-like DNA-binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR052435 all species →	Family	YY1-Associated Transcriptional Regulator	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan
IPR001005 all species →	Domain	SANT/Myb domain	Interproscan
IPR003822 all species →	Repeat	Paired amphipathic helix	Interproscan
IPR036600 all species →	Homologous_superfamily	Paired amphipathic helix superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16088 all species →	YY1 ASSOCIATED PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003712 all species →	Molecular Function	transcription coregulator activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23804	GON4L; GON-4-like protein	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002573-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

24.0Max TPM

12.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.38	16.76
polyp at pH7 6	18	18	13.27	19.49
coral polyp · control treatment	16	16	14.94	23.96
coral polyp · oil and dispersant treatment	16	16	11.21	18.05
coral polyp · oil treatment	16	16	14.00	17.67
coral polyp · dispersant treatment	16	16	9.95	19.43
Polyp	10	10	8.95	12.51

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.76
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.40
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.18
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.16
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.14
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.57
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.99
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.31
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.61
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.51
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.08
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.49
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.41
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.68
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.21
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.38
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.27
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.83
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.71
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.65
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.96
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.10
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.49
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.18
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.53
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.89
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.67
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.81
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.89
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.26
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.92
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.78
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.05
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.31
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.98
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.73
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.84
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.54
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.45
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.21
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.90
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.36
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.92
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.24
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.08
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.83
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.45
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.53
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.42
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.74
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.35
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.29
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.44
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.15
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.94
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.43
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.06
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.92
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.52
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.23
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.52
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.07
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.77
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.01
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.93
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.47
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.80
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.50
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.51
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.20
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.41
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	8.17
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.68
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.05
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.34

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.