Gene detail

Detailed information of OS493_002584-T1 in Lophelia pertusa

Genomic Location: scaffold_5:4850004...4874933
NR annotation: KAJ7365862.1, Cytosolic carboxypeptidase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002584-T1

ATGAGCAAGTCGAGCTCCAAGGGGAGTAGTGCGAGGATAGGCACCTTGCTTGAACAATTGCAAAAGCTGTGTCTTGCTGGTTCCGAGTCCAAATATGAACACGAAAAAATTGATGTTGAACAGTTACGCTACGTTACAAACAAAATCCAGCAACTTTTATCCTCTCAAGAAAAATGTCGCAAGGATCTTTCAACCAAGTTTGCGGATGGCCTTTCAACATTACTTGTTGTACTAGAGATGTCAATGGACACTCAGCTCACATTAAATATATTGGGCTGTCTGTGTGAATTGTTAACTACAGGTAAAAGAGCATCTGTTCTTGCAGCCAAGGGTACTGTGGATATTATTCTGAGAGTTATTGTGAATGCCAGTAAAGAGACATCTGTTTGTGAGGAGGTCTTGTTGCTTAGCCATGTCATTTTAACGAAAGTGGGACCCAAAGATCGTAAGCTGTGTGTTAAGGCTCGTTTGACTGGAGCTCTCCAAGTCACAATGAATGTGGTCAAGAATAACACAACCTTCTTCAAGGTCCTACAACCTGCTCTACAAGTCCTGAAACTCTACTCTGCCAATTCTGTAAATTGTAATTCCTTGGCCAAGTCAGGAGCTGTCAATGTGCTGTTCAGAGTTGTTACCAGCTGTGGTCACAAGAGGGTTATCTGTCTAAAGCTGGTGCTGGAGATTATTGCCACCCTTGTTAAGTCAAAGAGCTGTGCATCAAAAGCTGTCAGCTATGGAGCTGTTCCAGTGCTTTTACAGATGTTTTGTGATTGGCAGAGAACAGATCATCACCACAGACAGACCAACATCAGGAAAGCTATTCTGAATGTCATCAAAAATATCACCATGTCAAGAAGTGGTAAGAAGGCATTTATTCAAGCTGATGGCATCAAGACCCTGTACACTTTGTCACTGGAGACTCTAGAATGCCGTGAACTTGAGGGGGTAAATAATCTCAGTAGCCAGATTCTACGAAGGTGTTTTCCAACCAACAAGCTGCCAGTGTCAACACTGTCATCACCTTTGGCATTTGCTTTGTTGGATTTGGACAGTGCTGGCCACGCCACTGTTGAAGACCTCATGGATGACAGTGGGGAAGGTGAGTCAACTGACGTTGAATCAGAAGAAGAGGAGGATGAAATTAGCAGTGCTAGTCAAGATGATAAAGAAGCACTTGATGGTGGTAACAAGGCAGGGAAGTCAGAAAGTAAGGCTGCCAATCCGAACAAACAAGTCAAACCTCGAGATGACCTGGCCATGTATGAGAAGTTCTTTCCAGAACTGTTTGAATTTCAGGTTGAGGTTGTAGAGCCAATGGAAGATGAGATGTTTGTGTCATATCCAATAGTAATTCCAACAGCTGTTGAGGAGCCACTGTCATGTTCACCCACAGGACAGAGCCATCTGTCAAACCAGCTCGACTCTATGAATTTTGAAAGTCCACCCGGCAACTCTGAAGGAAGTCAACCAAAGACACAAGCAACAGCAACACAGGAGGAACTGACACAGGAAGAAAGACCTTGTTCCGTTGAGAATTCCACAGAGGAGATGGATAGCAATGGACACATACACAGTGTCCTGCCAATCATCAAGTCACCATCTCCTGATGTTTATGGACACTACCCACCAACAGAGCCAGAACCATTGGGACAGAAGAGAACAGGACTGCAGAGAACTATGATCTTCAGGGACATTGATCGGCAGATTCATCCTCTGAGAGTAATAAACAAAGTTGTTTTTAACTTGGATCGTTTGTTGAGGCAGGAGCCTGATGTGCCAGACAACTGTTTGTTAGCTGTAGCTAAAGAGCAATTCAAGTTAGGACATTCCCGTAAAGCTAGTAACTCCAGTATGTCAGAAGGTGAAAGATCAACTCCTGAAGAGTCAGCCAGACCACTGAAGTTTGAATCACGATTTGAAAGTGGAAATCTTCGTAAGGCTATTCAGGTGCGTGATTACGAGTATGATTTGGTCCTGAATCCTGACATCAATTGTAAGCACCATCACCAGTGGTTTTACTTTGAGGTCAGCAATATGGATGCTGAAATTCCTTACAAATTTAACATCGTCAATTGTGAGAAGATTAACAGTCAATTCAATTTTGGTATGCAGCCAGTCATGTATTCCACAACAGAAGCTCAGGAGGGACGAGCTGGTTGGATCCGAGCAGGAGCCAGTGTTTGTTATTATAGAAATTACTTCACCCGGAGCCGTGAAGCAACAGGTGGACAAGGCGGCAAAACCTACTACACATCAACCTTCACTGTTGCATTCCCACACACAAATGATACATGTTACTTCGCTTATCACTACCCCTACACCTTTACTATGCTTCAGAGTCACTTGTTACGCTTGGAGTCCACTCTAAATACAAGTGATGTATTTTACCGGCGCATGACGCTTTGCAACAGTTTGGCGGGAAATCCTTGTGACGTCATCACCATCACGGCACAGCCGCGGCGCAGAGATGCCAAGTCCATTGAGTTACTTAGAAACCGACCATATATATTCCTCACCAGTCGTGTTCACCCTGGAGAAAGTAATTCAAGTTGGGTCATGAAAGGAGTGTTAGATTTTCTAATGAGTAACTTCTACACAGCGCGTCATCTGCGAGAGACTTTTATCTTCAAGATAGTGCCCATGCTTAACATAGATGGTGTCATCAATGGCTGTCACCGATGTTCTCTGTCGGGCGATGATTTAAACAGGCGCTGGATCTATCCCAGCATGCTCCTTCATCCCACTATTTATCACGCGAAGGGATTGCTGTTGTATCTACAGTCAATTGAAAAGACGCCATTGGTTTATTGCGACTTTCATGGCCACTCGCGTAAGAAGAACGTGTTCATGTATGGCTGTAGCACCGCTGCCACAATGGCTGCAAGTTCTTCGAGTTCTGGTGAAGTGGACAGCAGTGACTTGGTGGATTCAGTGCGAGATCGAGTAGCTGAGCTGTCTGGCTCGGACTCCACCAGTAGCATGGACCCGAGTGACATAGACGAAGATCCCGGATATAGGACCTTGCCGCGAGTTCTTCACAATATTGCACCAGCCTTCTCTCTGGGCAGCTGTAGTTTCATCGTGGAGCAGTCAAAGGAATCTACGGCCAGGGTTGTAGTGTGGAAAGAGATTGGAGTGATTCGGAGCTATACCATGGAGAGTACGTACAGTGGCTGTGATCAGGGGCCTTACAAGGGTTATCACGTAGGATCAAGGGAACTGGAAGAAATGGGCCGATTCTTTTGTGCAGGGCTTCTCCGTGTTGGCCGCTCGTACTTCTACCGAAATAATCACGGACAATTGTCATCAAACGACAATGAGATGCAGAATGCTGATAGTTCATGGATAAGGACAAGTGAGCTGTTTGTTCCTTGTGAGCTCGTCAGTAGTGGAGTTGTCATATGA

Transcript

OS493_002584-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E1C3P4	Cytosolic carboxypeptidase 1 OS=Gallus gallus OX=9031 GN=AGTPBP1 PE=3 SV=1
Q9UPW5	Cytosolic carboxypeptidase 1 OS=Homo sapiens OX=9606 GN=AGTPBP1 PE=1 SV=3
Q641K1	Cytosolic carboxypeptidase 1 OS=Mus musculus OX=10090 GN=Agtpbp1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003584 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF18027 all species →	Pepdidase_M14_N	Cytosolic carboxypeptidase N-terminal domain	Domain	Interproscan
PF00246 all species →	Peptidase_M14	Zinc carboxypeptidase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040626 all species →	Domain	Cytosolic carboxypeptidase, N-terminal	Interproscan
IPR033852 all species →	Domain	Cytosolic aminopeptidase 1/4	Interproscan
IPR050821 all species →	Family	Cytosolic carboxypeptidase	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR000834 all species →	Domain	Peptidase M14, carboxypeptidase A	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12756 all species →	CYTOSOLIC CARBOXYPEPTIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004181 all species →	Molecular Function	metallocarboxypeptidase activity	Interproscan
GO:0035610 all species →	Biological Process	protein side chain deglutamylation	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23435	AGTPBP1, CCP1; cytosolic carboxypeptidase protein 1	EC:3.4.17.24	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002584-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

81.7Max TPM

20.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.43	31.88
polyp at pH7 6	18	18	19.81	24.20
coral polyp · control treatment	16	16	28.11	81.71
coral polyp · oil and dispersant treatment	16	16	25.12	53.95
coral polyp · oil treatment	16	16	22.86	33.78
coral polyp · dispersant treatment	16	16	14.56	23.85
Polyp	10	10	12.45	18.71

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.88
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.62
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.99
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.42
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.98
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.96
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.99
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.25
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.18
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.77
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.76
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.26
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.76
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.72
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.18
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.06
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.93
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.30
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.11
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.53
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.15
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.94
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.91
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.66
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.80
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	81.71
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.89
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.15
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.19
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.89
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.81
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.58
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.45
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.38
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.19
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.95
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.75
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.35
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.48
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.48
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.02
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.40
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.31
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.77
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.18
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.68
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.78
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.57
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.10
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.16
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.04
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.33
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.68
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.28
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.94
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.90
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.05
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.05
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.85
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.33
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.34
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.02
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.99
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.70
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.00
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.87
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.96
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.67
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.15
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.63
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.49
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.47
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.23
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.71
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	17.88
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.73
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	14.66
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.42
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.79
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.70
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.44
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.