Gene detail

Detailed information of OS493_002696-T1 in Lophelia pertusa

Genomic Location: scaffold_5:6609093...6635217
NR annotation: KAJ7365958.1, hypothetical protein OS493_002696 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002696-T1

ATGTTAGGAGGCACGAACGTCAAAATGAGCGGACCCTGCTTCACCGCGGAGGACAACATTGTCGTTCAGTTTGATAACGAGGTTAACATCAATGCTACTTTTGGCAGTGAACTGCAGTCCTCAATCACTATACCCGTATTGAACAAGACGGGAAGGTTGCCAATCAAACTCTCCATTGATGGTGGGAATTCTTTCGATTACAGTGCAGTTTACACATCAGTACCCATCAATCGATACACACCCGGTGTCCAACGAACAGACGGAGATTTATGGCAGGAGGATTCCTCAGTGGATATCAGTTGGGACGCGGGAAGTATTGGAGGCGCTGACGATCAAGTATCGATTGATTTGGCTCGCTATAAGATGGACGATGATGATATACCGGTACTGGACAGCTTTCACACTGCAGTGGACACACAGTCCAACACTGGTCACAGCCAGTTTGTTGTTACAAAAGGACAAGGGGACGGGTGCAAGAAATGGCATCTGAAGGAACCCAGTCCAGACAAATTCAAAGGTGATCCCAGCATGCAACCGTGCCCCAGGATTTTGACACAAGCCATGGTGATCGCGGGCGCTTCATGTCCGATGAAGAGTGCAATCCTTCCAATAGAGAAGGTTGTTCTCGCTACCATCAAGGAGCTGTCAACTGTTTTAAAATGGTCAAATCCCAGTGCCACAGGTGCCGGTCAACAGTGTTGTTATAACAGCTTTGGTAACTTGATGATGGGCAAACCAGATGCAGGATCTCTTGATCGAGTTCATCCTAATGCTGGGGTTCCCGTGATATCCCACTTCTTCCACGACATAGTTCCGTACCAGGACTGCTGCCGTCTGACGGACAACTGTGACAAGTATTTTGATAAGCGCCCTTCAGATGATGGCTCACAATATCAAGCGCCGAGACCTGCGACCGGATTTGGTGACCCACACATGGTGACGTTAGACGGTACGCCCTTCACGTTCAATGGTTACGGAGAATACTTCATTTTAAAAGTGAGCGGGGTGGACTTCACTTTGCAGGGGCGCATGCAACCTCTTGTAGGAGACGATGGAAGTTTATCACGTGCCACTGTTTATACAGCGTTTGCCGCCAAGGAGCACGGATCAGATACAGTGCAGATTCAGTTAAATGGCCGTGGATTGGTTGACGTTTTGTACGAAAACACCTTCAAATACTCCGCCATCTTTAATTCTGGGATCTCCGTTACCGTAGAAGGGCAACAAGAACTGCTTGGTCTCGTGACTTTGGTACCAACCATTTTCAAAGGGAATACAACTGGGCTCCTTGGATACTGGGATGACAGTAAAGAGTCGGAATTCCTTCGACCTGATGGAACTTTCCTGACCACGAACGCCAGCCTCGAAGTCATACACAGGGATTTTGGACAGCTATGGGTTACCAAACCAGACGAGTCACTGTTTGTCTACCAGCAAGGACAAAGCCACTCTACATTTCATAATCCCAGTTACCAGCCAATTTTCCCAGACAGCCAAAGCTTGGTCTTCACCGATAAATCGCTTGAGAAGGAGGCTCAGAACATTTGTGGAGACAGCTCGGAGTGCTTGTTTGATATTTTTACTACTGGAAAAGTGCGAATCGGAAGAGCAACAAAAGAAACTGTGAAACAATTTGTTGCCGTGGTCAACGATACTGTTAAACCAGCTTGTATGCCGCTAAATTCTCAGCTAGCTGATGGTGTTGTACACAGAAATGACACGGAAGGTGGAATCGATTACACGTTTGTGTGCAACAGAGGTTTCATAATGAACGGTTCAAATCACGTGACATGCAAAGATGGAGTTTACAACGGAACAGCCCCAAACTGCTTGCCAAGAGAGTGTCCCGCGCCTGGTCCAGGTAACCTCGCTAATGGTCGTGTACAAGGGAATGGCATTGTTTACCGTTCAACGTACCACTTTATCTGTAACGATGGATATGTACTTTATGGTCATAATATCATCACATGCATAGAAAATGGCACCTGGAACGGCACCATACCCAGCTGTTTGAAAGAGTGTCCATTACTTCCTTCATCCATATCCAACGGCGACGTCGATGGTTCTAGTCACCTGCAAGGCTCACGCTACATATTTAGTTGTCACGATGGTTATTCTCTCGTTGGCCAGGACGTTTTATACTGTACTGAGGAAGGAAGTTGGAATGCTAGTATTCCTACATGTCTGAGAGAGTGTCCTCCCCTTCCGTCGTCAATAACAAATGGATTTGCCCATGGCAGTGGCTCAGTGGAAGGGTCTCAGTACCAGTTCAGCTGTAAGAAAGGATATTCACTGGTAGGAGCGAACACACTGTACTGCAGCGATCAAGGAAATTGGAATGGCTCTATCCCAACCTGTCTCATCGAATGTCCGCAACTGCCTTCCTCTGTACCAAATGGCCATACTTATGGCACAGGCTTTTTACAAGGTTCCCTCTACAGATTCAGCTGTAGGCAGGGGTATTCTCTTATTGGACACAAAATGTTGCTGTGTACCCAGGATGGAAATTGGAATGCCAGTGTTCCAAGATGTCTTAAAGATTGTCCTAGCCTTCCTTCGTACATACCAAATGGAATCGGAAACGGAACTGGTTCAGTGGAAGGATCTCACCATCATTTCAGTTGTAACAAAGGATATTCACTTGTAGGGCGACACACATTGTACTGCAGTGACAATGGTACATGGAATGGCTCTTTGCCTACATGTCTCATAGAATGCCCACAACTACCGTCTACAATACAACACGGCAACGTTAATGGTTCAGGCCACGTGGAGGGTTCTCTACACAGATTTAGTTGCATCAATGGTTATTCCATTGTGGGACAAGATACTCTGTTCTGCAATGAGATGGGTCAGTGGAACGACAGCGTGCCTAGATGTCTCCGAGAATGTCCCATTCTCCCATCATCCATAGCGCATGGTGTCATCAACGGCAGTGGCTCACTCGAAGGTGCTCGGTATGAGTTCAACTGTGATAGGGGATATTCACTTATTGGGGTCGATACAATAGTGTGCACGGATGCTGGGGTATGGAATGGCTCGCTTCCTACTTGTCTCATAGAGTGTCCACGACTACCTTCGACGCTAAAACACGGCACAATTAATGGCTCAGGCCACGTGGAGGGCTCTCTGCACATATTTAGTTGCATCAATGGTTATTCCATTGTGGGACGGGATACTCTGTCCTGTACTGAAATGGGTCGGTGGAACGACAGCGTGCCTAGATGTCTCAGAGAATGTCCCATTCTCCCATCGTCCTTAGCGCATGGTGTCATCAAGGGCAGTGGCTCACTCGAAGGTGCTCGGTATGAGTTTAGCTGTGATAGGGGCTATTCACTTATTGGGGTCGATACAATAATGTGCACTGATGCTGGGACGTGGAATGGCTCGCTTCCTACTTGTCTCATAGAGTGCCCACGACTACCTTCAACGCTAAAACACGGCAAAATTAATGGTTCAGGCTACGTAGAGGGCTCTCTCCACAGAGCTAGTTGCATCGATGGTTATTCCGTTGTGGGACAGGATATTCTCTATTGTACTGAGATGGGTCGGTGGAACGCCAGCGTCCCTATTTGTCTCAGAGAATGTCCTAGCCTACCGTTATCCATAGCGCATGGTTTCGTCAATGGCAGTGGCTCACTGGAGGGGGATCGATATGAGTTCAGTTGTGAGAGGGGATACTCGCTTATTGGGATCGATATGTTAGTTTGCACTGATGCTGGGGTGTGGAATGGCTCGCTTCCTACTTGCCTTATAGAATGTCCAACACTTCCTCCGTCCATACGACATGGTTACGTCAATGGTTCGGGATCAGTACACGGTTCTGTGCACATATTTAGTTGCAAACATGGCTACTCACTTATGGGTGAACAGAATCTGTACTGTACTGCAGAGGGAAGATGGAATGGCAGCATCCCCAGATGTCTTAAAGATTGCACTCCCCTTCCCTTATCCATATCAAATGGTTTCGTCAACGGAAATGGGTCCGTGGAAGGGTCTCAGTACCAGTTCAGCTGTAGACAAGGATACTCGCTTGTAGGAAGAGAGACATTGTACTGTAATGACAAGGGAGCATGGAGTGCCTCTGTGCCAAAATGCCTAAAAGAATGCCCTTCTCTGAATGCAATAATTGATAACGGTTACAAACATGGCAGTGGGTCAGTAGAAGGTTCCTTGGCTTGGTTTAGCTGCAAAGACGGTTATTCTCTTATCGGAAATCAGTATTTGTACTGTGACGGGAACGGACATTGGAACGGTACCTCGCCAAGCTGCTTGAAAGACTGTTCGCAAATCAACAGCACCCTAGAACATGGTTACATCAGTGGCAATGGATCTACATCAGGTGAAGCTTATAGCTTTCACTGTGATGATGGTTACAGCATTGATGGAGAAACCATGCTGCGTTGCAATGAGTACGGACAGTGGAATGGCAGCATCCCTGTGTGCTCAAGAGTCCTTACAGGTAAAAAGGAAACAAGTATGGCCTGGTACGTCTACGCAGCTTCTGGTACCGGCAGTCTGCTATTTGTTCTTATTGCTGCAGGTCTTTTGGTACTACTGTGGCGTCGACGTAGGTCAAGTGTAAAACGGGAAGAATCCCCGAGCGGTGTCGAAGAGACAGAGATGGAAGCGATGGTGACTTCTCCAAAGAAAACTAAAGTCGAATGCAACGATTTGCTTGTCAGTGATGGTTCTGAAGCTCCTCCTACTGCGGTATGA

Transcript

OS493_002696-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1D5NSM8	Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1 OS=Danio rerio OX=7955 GN=svep1 PE=1 SV=1
Q4LDE5	Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SVEP1 PE=1 SV=3
P0C6B8	Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1 OS=Rattus norvegicus OX=10116 GN=Svep1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000637 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00094 all species →	VWD	von Willebrand factor type D domain	Domain	Interproscan
PF03782 all species →	AMOP	AMOP domain	Domain	Interproscan
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan
IPR001846 all species →	Domain	von Willebrand factor, type D domain	Interproscan
IPR005533 all species →	Domain	AMOP domain	Interproscan
IPR050350 all species →	Family	Complement & Cell Adhesion Regulators	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19325 all species →	COMPLEMENT COMPONENT-RELATED SUSHI DOMAIN-CONTAINING	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_002696-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04011	CR1, CD35; complement component (3b/4b) receptor 1	-	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002696-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

148.4Max TPM

38.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	19.30	36.59
polyp at pH7 6	18	18	19.00	41.23
coral polyp · control treatment	16	16	40.96	100.10
coral polyp · oil and dispersant treatment	16	16	83.31	145.13
coral polyp · oil treatment	16	16	37.92	54.90
coral polyp · dispersant treatment	16	16	51.30	148.44
Polyp	10	10	17.37	27.94

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.29
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.04
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.93
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.62
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.04
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.71
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.41
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.48
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.51
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.34
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.23
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.42
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.17
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.29
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.49
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.71
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.06
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.34
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.50
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.61
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.59
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	100.10
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	82.33
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.18
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.23
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.26
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.35
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.03
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.60
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.68
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	145.13
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	128.29
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	117.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	115.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	106.27
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	89.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.17
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.58
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	74.21
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.21
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.53
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.38
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.71
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.90
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.20
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.89
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.32
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.60
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.43
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.82
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.63
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.46
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.14
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.87
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.84
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	148.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.11
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.05
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	64.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.60
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.40
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.57
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.58
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.61
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.29
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.03
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.13
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.11
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.59
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.20
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	27.94
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	25.21
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	24.06
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	21.32
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.98
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.87
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.63
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.15
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	5.01

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.