Gene detail

Detailed information of OS493_002845-T1 in Lophelia pertusa

Genomic Location: scaffold_6:1039596...1066341
NR annotation: KAJ7340119.1, Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002845-T1

ATGTATTTGATCCAAGTACAAATCAACGACAGAAAATCGCAATCGGAATACTTGAAGACGAAGATAATTTCGTTATCGAAAGAGTACATCGATGCAATAGCGAAAGAGAAGGGCTTGTATTCTACAGGGCTCGGAGATGAGGATAATGGGGATGTACGCGAGTTGAAGAAAGCTACTGCTGTCCTGTTACAAAATATGCTGGCAAGAATTAAGAATCTGGAGAGACAAGTTGAAGATGTGATAGTGAACAGTACTGCAGAATTTAAACATCTTACCATAGCAATCAAGTCTCTGAACCGCACAATCAATAATCTCACCAAATCAACAGATGAGGATCTGTGTTACATTCCAGACAACCCAGCATATCCTGAATGCAGCAAAAAAGTAGATAACATTGGAAGGAAGATAAAAAGTATGCGGAAACAGGGCATCAATGGGAGTGTGTGTTCCATCCTTATATATCTTAGTGAGGTTGAGCAATGGTGTCCAAGAAATGTTTTTAAGCTCAAAATAAAACCAGTCACTGATGAGTATTGTGTTATGCCGTCTGATCCTGCCTTTCCTCATTGTGCTGAAAAAGTCAAGTGGATGGAAAAGTTCTGGAGATCAGACATGAAGTATCAAAGTCATGGAGTGGATGGAAACCTGTGTTCATTTTTGAAATATCTCAGTGAGGTGGAGAACTTCTGCCCCTTACGTTCTGGTCGACATATGGATGGTGACTGTAAAATTCCTGTGACCAAAGAATTCCCGGAGTGTGCCAGCAAAATTAATTGGATGAGACAGTTCTGGAAATCTGATAAATGTTATGAACAGGACCATGGCGTCAATGGATCAATCTGCTCTTTTATTTCTTATTTAAGTGAGGTTGAAAGGATACCTGACTTAGAAAGAACAGATGTGCAGGGCCTTTTAAACCACTTACAGGATGCAAATGCAGTTAAATTTCAATGGATGAAAAGACGTATTGTGCAGATGTGGCCTAAATGGCAAGCAGCAATTTCATCTCTGAAAAACAAGAAAGATTTGACTAAAACAGTGCAAAAGAAGGTTCTGATTCACATCGGTTTACTGGCAAATGAAAACAAACTGCACTTTGCTGAGGAAGCTGGTAAAGGAGGCCCGTTGGGTGAACTGGTTCAATGGAGTGATGTGATAACATCCCTGTACATATTAGGACATGATATTACAGTTACTGCAGATTTAGCTGCTATACAAAAGGCATTGGGAAATGTTGTTGCCAAGAAATTATGTCCCCAGAAATTGCCAAATGACATTGATCTTGTGTATGTGGATTACATTGGGCTCAGGGAACTTAACTCGAAGATTGGCACACTTTTACCGCAATTCTTGTGCAAGCTGCGTGTAGTGGACTCATTTGGTACTGAGGCACAGTTCAACTTTAATTTGTACAAAGAAAAAATCGATGGTGGATCTATGGGGGCATATGGACGATACAACCTCAACCTACGACAGTACCAGACCATGTTCCCTCACAGTCCTGACAATACATTTCTTGGTTTTGTGGTGAACGTCAAGCCACTCGAGAACACTGATAAAAAGATGCGAAGAAAGGCCAAAGCCCTTGTGTACGGCAAACATTACAGCATGTGGAAGGACTTACCGAACAAAACTTTTCTTGAAGTTGTTAACAGATATTTAGAAGTACACGCCACTGTGGGGGGAGGGAGTGCCAGTGAAGTGTCGAGCCATTTGCCAAGTTTTGTAATAAACCATGGTGTTGTTACACCAATGGAAGTTCAGAAGCTGTTAAATGAATCTATGGTTTTTGTGGGACTTGGTTTCCCGTATGAAGGACCCGCACCTTTGGAAGCGATTGCTAACGGATGTTTTTTTATTAATCCAAAATTTAATCCACCAAGGAGTCGACTGAACACACCGTTCTTCAAAAACAAGCCTACACTTAGACTGTTCACTTCGCAGCATCCGTATTGCGAGGAGTTCATTGGCAAACCTCATGTGTACACCATTGATGTGAAAAATGTGTCTGAAGTTGAACGAGTCATGAAGGAAATTATGCTTAAAGAGGTGGATCCTTATCTTCCGTTTGAGTTCACTCACGAAGGAATGTTAGAAAGGGTGAATGCTTTGGTTCAGCATCAGGATTTCTGTTACCAGAATCATTGGCCTCCTTTAAAGGCCTTGATAACCGAGAAAGGAGGAGCTGGAAAATCGTGTAAAGACGTCTGCCTTGCCAAAGGTATGGTGTGTGAACCAGAGTTTTTCAATAGCATCAACTCTCGTACTTCATTAATTGAGCATGGTTTCCCATGTAACACAAGTCGTCTTGAGGAAGTACCATCCCTCATCGCTCCAGGCTTCCGACCGGAGCCCGCGGCCTGTATTGTCCAGACCCAGGCCCTTATGTTCAGCTGCACGGGAACGAGTCCATCAACCATGCGCTTGTGTCCATGCAGAAAATACAAGAAGGGACAGGTCGCCTTATGTGTTGACTGCTGA

Transcript

OS493_002845-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8R4G6	Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A OS=Mus musculus OX=10090 GN=Mgat5 PE=1 SV=1
P97259	Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A OS=Cricetulus griseus OX=10029 GN=MGAT5 PE=1 SV=1
Q08834	Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A OS=Rattus norvegicus OX=10116 GN=Mgat5 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000465 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15024 all species →	Glyco_transf_18	Glycosyltransferase family 18	Family	Interproscan
PF15027 all species →	DUF4525	Domain of unknown function (DUF4525)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR026116 all species →	Family	Glycosyltransferase family 18	Interproscan
IPR027833 all species →	Family	Domain of unknown function DUF4525	Interproscan
IPR052105 all species →	Family	Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15075 all species →	ALPHA-MANNOSIDE BETA-1,6-N-ACETYLGLUCOSAMINYLTRANSFERASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006487 all species →	Biological Process	protein N-linked glycosylation	Interproscan
GO:0030144 all species →	Molecular Function	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity	Interproscan
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00744	MGAT5; alpha-1,3(6)-mannosylglycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	EC:2.4.1.155	Glycosyltransferases	ko01003	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002845-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

65.0Max TPM

29.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	33.78	50.17
polyp at pH7 6	18	18	31.08	46.54
coral polyp · control treatment	16	16	35.20	65.01
coral polyp · oil and dispersant treatment	16	16	22.16	39.16
coral polyp · oil treatment	16	16	31.15	59.85
coral polyp · dispersant treatment	16	16	23.40	48.02
Polyp	10	10	25.83	60.25

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.17
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.09
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.22
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.34
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.19
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.97
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.25
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.98
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.65
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.82
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.70
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.45
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.05
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.81
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.38
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.72
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.01
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.68
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.22
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.48
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.26
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.72
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.11
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.00
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.26
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.77
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.71
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.50
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.72
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.73
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.93
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.98
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.16
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.44
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.32
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.97
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.68
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.58
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.25
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.80
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.42
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.38
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.16
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.85
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.54
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.77
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.27
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.05
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.53
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.32
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.53
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.70
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.88
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.66
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.02
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.95
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.75
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.53
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.30
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.07
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.99
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.03
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.42
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.82
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.53
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.31
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.05
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.91
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	60.25
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	49.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	36.38
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	35.49
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	31.87
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.02
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.25
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.20

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.