Gene detail

Detailed information of OS493_002925-T1 in Lophelia pertusa

Genomic Location: scaffold_6:2284747...2299565
NR annotation: KAJ7340194.1, Coiled-coil domain-containing protein 40 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002925-T1

ATGGCGGACAGACCAGAAGAAAACGGGCTTAGCGATAGAGAAGGAAAAGAAGGCGAACAGAGACCGGTATCCGGAAGATCAAAAGGCTCGGCTGATTCCAAAAAGTCTATTCAAGATGCAGTTAGCAAATTGACTGTCAATGCTCTGAAAGAGTTTCGTTTGAGCGACCCGAGTGATGTAGATACTGTGATAACCGGTGCAGAGAGTGAGGGTCTTGTTCCTACGGCAACTTTAACCCAGGATATTCCCACGTTTGATCCTCAAGGAGCTCCTGGAGCGCAGACGTTGCTTTCTGAAGGTATTAGCGAGAGTGGCGAGGATGCGAGAGAGGATGAGATCGGGGGTGATGAGGGTGAAGACGGGGATGAAGATCTTAGTGATGAGGAATCTGGTTCTGATGGGGAAAGTGACATGGTGGTGCTCGATCCAGATCATCCTCTCATGGTCAGATTTCAAGCTGCATACAAATCACATTTACTCAAGCAGCAGGAAAAAGTTCATTTGGAGCTAAGAGAACTGACTGAAGATCTTAAAACCAAGAAGCGTGAGAGAGAAGAACTTGGTGTACAGTTGTATGGAGTTCAACAGGAACTTGCTAGACAACAAATGCTTTTGGAAAAGGAACATGATAACTTCAACTCAGAAAATCAACTGAGACAACAATGTGAACAGTTGCTGGATGAAACTAAAGAATTACATGAGAAGACATCGCAAGATGTTAATCACCAGCGGAAGCAAGCCAAGGAGCTCAGAACAGAGGTTGAAAACCTGGCGGCTAGGTTACATTACATGGAGGAAGCTAAGGAGGATGTTAGGGCTGATATTGCTGTCATGAGAAGAGCAGCAGAAAAAGCAGATACTGAAGTTACCAAGGCTGAGACAGATAAAAAGAAACAGGATCTCCTTGTGGACAGATTGACGCAAACTGTTGATCGACTGAGGGAAGAAATTGACATGTTTGAGACTCAGTGTTCTGCTCAACTGGAGGAAACCAAAGTTGCGCAAAAAGCACTTTCAGAGGCTACCACAGAAATAGAGGCTCTTCAACTGGAGAGAAAGCAGCTGATGCAGCAGTGGTACAGTAGTTTGATTGGAATGAGGCGGCGTGATGAGGCTTTTGCTGCAATGCAAGAAGCTTTGAGTCTCCAAAGACAGAGAATCCAGGCCATAGAGACAGAGATTGAAGGCTACAGAAAGTCCATCAGTAAAGCCCAGGAACAGAATGAGCAGATCACGCTCATGCACAACAAGATCGAAGCTGACATCTCCATGGTGAAGAAACTGATCGCAGTTAGTAGAAATAAACAGGATGTACTGAAGACTGAGTACAGCAAGTACACAAGGACACTCCATGAAACAGAACAACATCTCAACAGAGCAGAAACTGAAGTCACGCTAAAGGAGAATGAAATCACAGCTCTTAGAAAACAGATTGAGCGAGAGTTCATGGAGAAGATTAAACTTGAAGATAACATTATGGAGAAGATGAGAAGCCAGCTCACATTGGACAAGGCTGCGCAATACACAAAGAAAATGACCGACAAGCTCAGGAGAAGAGCCACTGAACTGGAAAGTTCAGTAGCTGAGGTTGAGAACGAGATATCCAGAGACGTTCTGGATATTTCCAACACCACAATCCGCGTCCGTCAGCTTCAGGACGTCATGGATAACTTGAATGACGAGATTCACCAAAAGAACGCCACCATATCTAAGATAGAAGGAGAGATTGTGAAGCGAAATGCCATTATTGAAAGGAAACAGAGCACCATTGACCAGTATAACAAAAGGATTGATCAGATGAAAAGCAAGGATGGGGGAGAGGAAATAGGACCACTGGAGCTACAGATCCATACATTACAAAAGCAGATCGAGGCTCGTTTGAATGAAATCACCGAATTACAGCAGTTCTGGCTCAGAAATCAAAGCGAACTGGTGAAGACCTTGAAGGATGTACAGAAACAGTCTGAAGACATGGAGTACCTCAAGAAACAATACACCATCTTACTACAAAAGAAACTAAGGATAGAAGGTGAAATTAACTCGCACAACAACGAGATGCAAGATATTGAGCGAAATGTTCGGAGCATGCAGAACGACATGACCAAGTTAAACACGCTCATCACCAAGGAGAGTGGGCTGAGAGAAGCGTTACAGCAGGGAACTGTTTTGATGGAGAGCGACTTCATTCAGGCACTCAAACAAGTTGAAGGAGAATCGATCGGCATGCAGAATCAAATTGACGCTCTGAAGGAGGAGAAGGAAAGACTGCTCAACAGTTTGGTGGAAGCAGAACGTCAAATCATGCTGTGGGAGAAAAAGACGCAACTGGCCCGTGAAGCGAAGAATGCTGTTGACCTGGAGTACGGCCAAGGGGAGATCAGAGCCATGAAAGCTGAGATACACAGAATGGAGGTTCGTTACTCCCAGCTAATGAGGCAGCAAGAGAAGATGATACAAGACATGGAGAAGTCTGTTGTACGTAGAGAGGTCATTATCACGCGTGGTGATGCTCAGGCAAAGATGGGTAAAGTGACGAACACCAAAGGTACCTTCCAAAAGAAACTCGCTGAGATGAAAAAGAAAATCAAGCAAACGAACCAGGACGCCAATGCCTGCGACACTGATATTCAAGTGCTGCGTGAAAAGCAGATGTCTGTGAGCCACGATCTGGAGGAGAAACAGACGACATGTCAACAGCTACAGACCAGTGCTGATGAACTGGAGGTACAAATCGACACACTGTCAGAGGAGAGGCAGAGGAATCTGGCTGATATCGTCGCAAAACAGCAAAGTTAA

Transcript

OS493_002925-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4G0X9	Coiled-coil domain-containing protein 40 OS=Homo sapiens OX=9606 GN=CCDC40 PE=1 SV=2
Q8BI79	Coiled-coil domain-containing protein 40 OS=Mus musculus OX=10090 GN=Ccdc40 PE=1 SV=1
Q56A40	Coiled-coil domain-containing protein 40 OS=Danio rerio OX=7955 GN=ccdc40 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006471 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08647 all species →	BRE1	BRE1 E3 ubiquitin ligase	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR037386 all species →	Family	Coiled-coil domain-containing protein 40	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16275 all species →	COILED-COIL DOMAIN-CONTAINING PROTEIN 40	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0035082 all species →	Biological Process	axoneme assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23730	CCDC40; coiled-coil domain-containing protein 40	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002925-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

53.4Max TPM

18.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.04	25.32
polyp at pH7 6	18	18	12.65	19.82
coral polyp · control treatment	16	16	25.61	53.40
coral polyp · oil and dispersant treatment	16	16	23.47	46.26
coral polyp · oil treatment	16	16	21.77	26.92
coral polyp · dispersant treatment	16	16	18.65	26.68
Polyp	10	10	14.68	19.18

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.78
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.69
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.21
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.75
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.14
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.21
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.88
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.87
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.55
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.45
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.41
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.17
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.14
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.70
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.50
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.26
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.88
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.12
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.57
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.01
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.69
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.47
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.15
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.10
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.34
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.33
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.96
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.85
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.56
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.41
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.74
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.38
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.90
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.90
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.96
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.98
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.70
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.44
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.73
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.86
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.26
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.28
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.16
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.06
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.93
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.80
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.68
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.53
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.49
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.41
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.32
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.81
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.98
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.92
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.06
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.60
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.41
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.14
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.08
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.07
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.57
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.03
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.31
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.09
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.68
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.32
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.01
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.05
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.76
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.86
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.79
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.98
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.84
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.21
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	19.18
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	17.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.78
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	16.14
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.95
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.04
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.89
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.58
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.29

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.