Gene detail

Detailed information of OS493_002931-T1 in Lophelia pertusa

Genomic Location: scaffold_6:2361753...2368446
NR annotation: KAJ7340200.1, hypothetical protein OS493_002931 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002931-T1

ATGAAGCGTTTCAGTATCCAAGCTAAAATCCTTACAGTTGAAGGTGGAGCAGCGATCAACACGTTTAACATGAATATAACCGCTATCAATCTTACAGTGGATGGACGGTGGCTTCATCGATGGAAGCGATGGTGGTTACCTAGCAACCAAAGGACCAGGCGGCTTGCTGACAAACAACTGGAAGCGTGGCGGCGCCGGGCATGGCGGGACGGGTGGACGAGTCGAGATATCAACAATAACAATGGCGGTGGAAGCGGTGGAAGTATCTTGATTCATACCCAGGTCCTCTCTGGGGGCCACACAGGTATTATACAATCACGTGGTGGAAGTGGTACCGCGGGCTCTGGTGGTGGATCGGGCGGTCGCATAGCCGTCTATTACAGCAACAATGACACACACCACCCATACAGGGGGAGATTCGATACGAGTGGTGGCAGTGTCACTTCCGGTGCGGAGGCAGGTGCCTCTGGAACAGCTTATCTTAAACACACCGGAAGTGGATTTTCGACGCTTCGAGTCGACAACAATGGACAGCGTTCTCTGGATAACGAGATCCCGAACGTAGGTCGCCTGTTAGATCTGTCAGGAGGAAATATTGACCAATCCACATCGTACAGGGCGCCGAACGGGATGACGGTTACGTCAAGCTGTTCATTAAAACAATCCTCTTGTCGTAACCCGTGTTACAATTGTCGTGACTACGCTATGGCATACTTGTTTGACCAGTCATTTTCCACCACTAGCTGTGTTGGTTACTTCTTATCTAACTGCCGGTACACAAAACTGACGGTCGATTTAAAGAAGTCACTCTTTATCAACCACGTCAGAGTTTACCCATATTGCAGTGGGACTCGACCTAACTTCAAGGTCACTACTAATGATGGAATCAGTGATGTGCCTGTCACAAGTGAATACGTTGACATGTCCAATGGCTGCATTCAAGGCTCTTATGTTGATATGCCCGTGAGAAGAAACGCCACAAAGATATATGTGGAGCTCAATCATCATCGCGTTAGTAACACTGGCAGTGGCCTCTCTGAGTTGGAAATATTTGTTGAAGGAAAAGAGGTGTGGGAAAGGTACAAGCATAGGAGTTTTGATGGCGCCAAAACCTGGATAGAGCCAGCGGCTGACACCAATTTCCACAGCTTCAATGAAGTGCACATTCGGAGATCTGCCCAGCTTGCTGTAATGCCGCTGAATGGTTTGCAGGCTCCTGTACACTTTCATGCTGACAGACTGTACGGGGATAAGAGCGGATTCCTTCATGTAGGATACCATCAAAATTTCTCTGTGGCCGTCACCGATCCCGACATCCCATTTGGTCTTCGTGTTTATGAAAATGGAAGCATGATGTTGCCGAGACGCGCTTTCTTGCAAACAGTCAGCTTCAAGTCTTCAGGGAAGATCTGGGGCATTCATGACTTGTTCGTGTTCGATCATGGATCATTCTACTCTGATTCAAACTCAAGTCTTGGCAGTGATACCGCTCCTGGAGAATACTCGGTCCAGTCCCTTCACGTGCAGGACAGAGGCGTGTTTGAATTGCATTCCTCTGACAAGGATTTAACAAGCCGATTGTCGCTCACTAACTTGACGATTTTTGGCGGTGGCCACTTCAAATCCAACAACAAATTAAACATCGCGGTTCATCATCTGTTAAGAATAAACTCTGGAGGAAAACTGAGTCATAATCATGCTGGTTACGTCACTAAGGAGGGGAGGCCTGGGAATGAGTTTGAACCATCTGAAGGACCCGGCCAAGGGTCTGGTAGCGTCTATGGAGCGAGTGGTGCTGGCTATGCCGGAACTGGTGGAAGAGGGACTGGGGCGAATCACGTGGGTGGCCTGTATTATGGAGATTACCGCACGAGTTCAGTGGGCCCGTATAAAAACCTCATCACCCGAAGTGGACTGGGAGGACAAGGAGGCGGAGCGATCAAGATTGTAACGCGCCATTTGATTCTTGATGGACACCTGTCAGCAGATGGAGAAGACGGCCCTCCCCCTAGCACGGCAGGAGGGGGCAGCGGAGGAAGCATCTGGATAGACTGCGAAGAGTTGGACGGCTACGGGACGATCAGTGCCAAGGGGGGCTCGGGGTCCCCAAGTAAGGGTGGAGGGGGGTCAGGTGGCCGAATATCGATTTACCACGCTTTCATGCTCAATTTCAACGGAACACTTTCCGCCAAAGGTGGAGATAGCGGAGTTGAACCCGGCGCTTCTGGAACTGTGCTTCTTGAGACTCGAAACGACAGCAAAGTGGAATACAGAGTGTTGAAGATCAATAACTACGGATTAGCGTACCCTTGGGCTGTGGATAAATCGCAAGGGAGACTTCGGCATCTTATGAAGGGAATATACAGCGATACCAGATACATAGGAGCTGTCACATGGCTGCACGAAGCGGACTATTACACCTTCGATGAGTTCCATCTCCATGGAAACTCGCACGTGGCCCTGTACGGAAACGCGTCTCGCGAGAATGTCACACTGTACGCGCAAACGCTGCGCGGCGATCGGAGCGGCGTGCTTCACATTGGTCGCTTCCAGTCCGTAGTGTTTAAGTTCGTTGACTTGTATTTCCCGATAATACACTAG

Transcript

OS493_002931-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001112 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_002931-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

No InterPro signature was detected for OS493_002931-T1. This gene does have a gene model — the search simply returned no hit.

PANTHER

PANTHER term	Description	Source
PTHR31513 all species →	EPHRIN TYPE-B RECEPTOR	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_002931-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002931-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002931-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

100TPM > 0

7Conditions

93.7Max TPM

15.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	15	0.58	1.08
polyp at pH7 6	18	13	0.80	2.17
coral polyp · control treatment	16	16	18.57	48.26
coral polyp · oil and dispersant treatment	16	16	39.37	93.65
coral polyp · oil treatment	16	16	25.85	65.22
coral polyp · dispersant treatment	16	16	23.11	59.88
Polyp	10	8	0.39	1.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.01
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.87
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.87
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.75
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.65
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.65
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.59
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.51
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.39
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.28
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.17
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.91
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.23
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.13
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.08
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.78
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.70
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.59
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	48.26
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.19
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.69
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.10
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.27
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.04
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.10
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.80
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.43
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.38
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.87
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.65
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.12
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.69
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	54.45
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.06
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.50
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.54
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.23
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.57
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.64
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.11
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.69
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.08
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.38
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.22
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.07
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.01
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.77
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.95
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.15
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.33
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.58
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.79
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.30
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.38
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.70
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.49
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.72
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.01
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.97
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.96
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.32
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.65
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.58
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.80
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.37
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.53
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.26
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.05
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.04
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.