Gene detail

Detailed information of OS493_002932-T1 in Lophelia pertusa

Genomic Location: scaffold_6:2368503...2373911
NR annotation: KAJ7340201.1, hypothetical protein OS493_002932 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_002932-T1

ATGGAAATCAACGGAACTCTTGCCGACTCCGATGAATACACCATCGATAGAGATGGAAAGCTGTTCCTGTGGTCTGGTGGCAAATCACTCGGAGAAGAACTGGGCCACTTCCGGTTCATCAACATGTCAATCAAGTCGTTAGGTTTGCTGCACACCACAAAGCTTCCGGGTCATGGCCCAGTGAGTCTGCACATGACACGTTTTGTTGTGAACGCTGGCGGGTTGGCCAGTGTCGACGACCTCTTTTTAGACTCCGAAAACGCCACAATTGATGTTGCTGGTGACGTGTCAGCAGACTTCAGGGGACATGGTGCCGAACAAGGACAAGGAGCTGGTATTCGGCGGACTTCCTACAACACCGGAGCGGGAGGTGGGAGCCACGGGGGCCGGGGTGGACGGGGATCAGCCGGTCTCCAAACTTCCTATTCATACGGTTCAATATACGAACCCACACAGTACGGCAGTGGCGGCGGCAACGGCTTGCACGGCTCGGTTGGCGGGCGAGGAGGCGGTCGTATTGTTTTTGAAATATCAGCAATGCTGCGACTTGAGGGGCGCGTGCATGCGAACGGAGAACCAGGAAGTGACAATTCCGATGCGAGCGGCGGAGGTGCCGGGGGAAGCATTGTGATCCGCGCGTTAAATTTTGACGGCGAAGGCACCGTCTCGGTCAATGGTGGGTCGCGTTCTTCAAGCTCTGCACCGCATGGCGGCGGTGGGGCAGGCGGACGCATTGCTGCCTACTACAACGGTAACTACACCTTCATTGGATCCTTCCAGAGCTATGGAGGAAGCAGCCAGGCGGAGTGGGGTGGAGCAGGAACTATTTACACGGAAAACAACCGCAACGCCAGCCAACCTTACCGCACTCTTAGAATTGACAACAGAGTGTTGCCTAATGGACCGTCAAGGCTTCAAGAGACACAGGAACTAAATCTTGCAGGGAACAGAGCTGATTATCCTTACTACATGACGTCATACCAAGCCCCAAACGGAGTTATCTTAAGCACTACGGGAACACCTTATTGTCGACAAACGCATCCTGGCGATTCTAAGCAATGTATAAGCGGCAACTCGAAGATGACGAACTTATTTTCGTCAACGTCCGATCATTATTACACTCAGCATTCGAGCCCAGTTCTGACGTATCTCTTTCCGTTGCCTCTGTTCCTGGAGTACTTGCTGGTTTATCCTCACTGTAGCTCGTACTTTTGGACTCGGTATAACGTACGTATTTATTTCAATGGCAGTGAAGTTGCTGGATCCAATGGCTGGATTAACCCAACCAATTGCCTTCAAGGACAACCGGGCAGAATAGATGCTAGACTAAGAGTTGATAAGGTAGTTATAAGTCTCCAGAAACTCAGCACGAACTCTTCTCTCAGTCTCGTGCGGTTCTTTGTTCGTGAAAATCCTTCGACCACGTTACAAACGCCACATTACACGAGCCCCAGCACCTCGTGGATCATAAGTAAAGACGAGCAGACGAAAGACCATGACTTTAATGAGCTACAAATCATGGGCCAAGGAAGCCTGTCGATATCTGGGGATAACGTTAAAGTGAGCGTCGATAAAATTGTTGGTGACAGCAGTGGTCTCCTGACAGTGCGCCCCACCCAGGCCATTCACATGAGGGGCTCAGAGGGACACCTTCCATTTTCGCTCCTGTCACAAAAAGGCTCCAATGTGACCTTCCCCACAAGCATGAGCTGTCGTGGAGTCGAGGTGGCGATGCGTGGCGTAATGGGAGAAATGACAAATCTCACTGTCGGACCACAGTGTCGGTTTGTTCTTCAGAACTCTACAGAAACGGACTTCGCGTTAGATCACGTGGTTGTACAGACGGAGGGCTACATGGCGGCGCTCAGAGAAGACAGGAAAGATGTGCAAATGATTGGAAAAACGTTCGACATAAGAGGAGGAGCCAAGGTGGAGGCAAACAGTCTCACTTTGGACTACATCAACATCACTATAGAACCCTTCGCTGACCTCTCGGGCAATGGCCTTGTTGATGAAGTTCCCGGATCACGTTACTATGGAGACGGATGGGGTGGCGTCTCTGGCTCCTCCGGTGCAGGGCATGGCGGTCATGGCGGGCTGGGTAAAGGCCAATCAAAGGTCGGTGTCTCATACGGGAAATACAGAAGACCCACGACATTTGGAAGCACGGGTGGAGCTGAAGTTTTCCCGTTCACCGGCGGATTAGGAGGAAGTCGATTTAAAATCATTGCGCATGATACACTAGTGGTCGACGGGGTATTATCCTCCCGTGGGGGAGATGCTCGGGCTACTCGTAGTGGCGGTGGCAGCGGTGGTAGTATTCTAGCGTACGCATCAAGAATCCATGGCGACGGAGAATTCGACGTGTCTGGTGGCGACGGGGACAGCTCCACCGGGTACTATGGGGGTGGGGGTGCGGCTGGCCGTGTTTGCTTATACTATCGAGAGAACCACTTCTTAGGTCGTTATCTTGGCAGAGGCGGGGATAGTTCATTCGAACCCGGGGGTCCAGGGACAGTGTTTGTAGAGAATGTACCTGGAATGAACGCTACTTATGGGCACGACCGTATTGACGAAGCAGCTCATGCAGAAAGAGTTGTTCTTGACGAAGACGTTATCAACGGAACAAAATGGACTCGAAATAGAACGTTGTATGCAAACGCGTTGGGACGGACACCTCGAACTCCAGGCGCTAACCTAAGCTCAAGCTACAGTGATTTCAGTCATGGCGGGTCGAGCAGGTTGTGGCTCACTTTGGATGACAAAGATCTGGAAACCAACGGAACTGATGTCGAGCTGGACGAGTTACAACTTTACGGTGGAGCACAGCTCGCCATCATAAATCCAGCAAGCACCAAAGCGCGTATATCGATAGTGATTGGTCAAATGGAGGGCGATAGAACAGGAGGAATCCATCTGGGCTTCAACCAGACGTTCCTCTCCCTCCAGTCGTATCTCCCCATGGATATGATCATTTACCAAGGGAGCGTGACCACCATGCAGGGAGAACTGCTCGTTGCCGGGGTAACGGTCGAGATTGACGGGGTTTTGAGAAGATGCCAGAATATTACTGTGGTCGATGATGGAGTTATTCGCATGAAAGAGATGTACGACACGGAGGGAAAGCCGACCAAGGTAAGAGGAATATGCAGTTGA

Transcript

OS493_002932-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001134 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_002932-T1 in Lophelia pertusa.

InterPro

No InterPro signature was recorded for OS493_002932-T1 in Lophelia pertusa.

PANTHER

PANTHER term	Description	Source
PTHR31513 all species →	EPHRIN TYPE-B RECEPTOR	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for OS493_002932-T1 in Lophelia pertusa.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_002932-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_002932-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

103TPM > 0

7Conditions

96.2Max TPM

15.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	0.59	1.08
polyp at pH7 6	18	14	0.89	2.15
coral polyp · control treatment	16	16	17.73	42.41
coral polyp · oil and dispersant treatment	16	16	38.31	96.25
coral polyp · oil treatment	16	16	26.12	64.93
coral polyp · dispersant treatment	16	16	21.74	56.79
Polyp	10	8	0.36	1.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.08
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.04
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.99
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.94
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.73
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.68
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.66
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.57
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.57
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.57
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.39
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.37
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.33
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.32
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.28
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.28
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.15
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.13
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.47
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.43
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.08
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.00
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.94
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.71
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.71
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.37
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.41
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.01
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.86
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.81
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.99
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.50
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.08
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.94
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.37
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.61
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.66
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.96
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.25
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	79.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.05
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	45.06
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.36
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.73
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.14
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.87
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.74
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.49
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.26
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.85
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.18
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.93
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.68
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.73
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.98
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.88
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.97
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.77
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.25
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.21
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.06
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.60
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.04
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.75
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.07
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.40
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.54
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.81
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.70
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.89
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.70
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.44
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.52
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.61
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.53
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.09
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.01
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.08
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.23
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.13
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.