Gene detail

Detailed information of OS493_003064-T1 in Lophelia pertusa

Genomic Location: scaffold_6:4590541...4617595
NR annotation: KAJ7340328.1, hypothetical protein OS493_003064 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003064-T1

ATGGCGGACGAACAATCCCTATCTTATAGTCTTGATCATTTTACCGAATTACAAGAAGTGACAACACTGATCGAATCTATAGGACCCATATGCCACGATGACATCTTACTAGAGGCTGCCGAGGAGCGATTTATTGTGATACTGAATAAATATCAGGAACAGCCACATTTACTGGATCCACATTTAGAAAGCCTTGTACAGAAACTACAGCATATAGTGCGTGATCCATCAAACCCTGCCAAAGTGATTCAGCAGGCCTTCAAATATCTCTATCTTATAACCAAGGTTAGGGGACCAAAATATGTGGTGCGACTGTTTGCTCATGAAGTTACCGACGTAGAACCAGTTCTTGGAATGCTGTCTCAGCAAAATCCTCAAGATCATGAGACCTGGGAGACACGTTATGTACTGCTACTCTGGCTGTCAATTGTCTGTATGGTACCCTTTGACATGGCTCGCTTTGATGGACTCAAAGAAGGACATGCTGGAGCAGTGGAAAGGCGCAAGCCAGTGGTGGAAAGGATCCTTGAAACAGCAAAGGTTTATCTGTCAGTTCCTGATAAATCACGAGATGCTGCAGCTTTAGTTATTTCAAAGTTTGTAACAAGACCAGATGTAAAGAAAGTGAAGTTGGCTGAATTCCTGGACTGGTGCTTGATACGAATGGAAAAGGCAGATGGAGAAACAATGGATGGCATGCTGTTACTTACAGGGATCTTAACAACACTGGCTTTGCTTTTCAAGCATGGGAAAAGAGAAGACTTAATACCTTATGCTCCCATAGTCTTGAAGCAAACTGGAGCTTGTCAGATATCAAATATCAACAACACGCTGCTGAGGAAGTTAAATATCAAACTTATACAGCGTCTTGGTTTGACTTTTCTGAGACCAAGGGTGGCAGCTTGGAGGTATCAACGAGGAAGTCGTTCCTTGGTATACAACTTGGCAAATCCATTCGCACAAGACCAGAATGGAGGACATCACCATACCGCAGAATTTAGCACAGACACAGAAGAAGAATACGATGTTCCCGAAGAACTAGAGGATATTATTGAGAAACTACTGACTGGCCTTAAAGACAAGGACACAGTTGTAAGGTGGTCGGCAGCTAAAGGGGTTGGACGAATAACTGGTAGACTTCCTCAAGAGCTAGCCGACCAGATTGTTGAAAACGTCCTAGAGCTATTCAGTTTCAGAGAATCAGATTGTGGTTGGCACGGAGGATGTTTAGCCCTTGCTGAGCTTGGCCGAAGAGGACTTCTGTTACCTGACCGGCTTCCTGAAGTTGTCCCTGCTGTGCTGAAAGCCTTGTCTTATGATGAGCTGAGAGGGACGTACAGTGTTGGGAGTCATGTTAGAGACGGTGCTTGCTATGTTTGCTGGTCATTTGCCAGAGCGTATGATCCAAAGGAAATCCAGCCACACGTCCAGGGAATAGCCAGTTCTCTTGTGACCGCTGCTTTATTTGATCGTGAAGTGAACTGTAGACGGGCAGCCTCTGCTGCCTTTCAGGAAAATGTGGGAAGACAAGGTACCTTTCCACATGGCATTGATATTCTTACGATGGCAGATTATTTTGCAGTTGGAAACAGAGTGAATACGTATCTGAATGTTAGTGTATCGATAGCTCAGTTTAGGGAATATACCAGAGCCTTGATTGACAACCTAGCAGATGTCAGGCTACAACACTGGGACGGAAACGTTCGTGAACTGGCATCTCAAGCATTACACAACTTGACTCCTGCAGAGCCAGAATACATGGCGAACACAGTTTTGCCTAAGATGCTTTCACAAACGAACAACATCGACCTCAACACTCGTCACGGTAACATTCTGGGATGCGCTGAAGTAACTCATGCTCTACATCTATACGCTCAACAAAGTGGAAGATCGCTTACAGATGTACTTGACAAAAACTGCTTTGAAGTTCTGAAGGACATTGTACCAAAGCTAACAACTGCAAAGCGTTTCAGAGGTCTGGAGGAGAGTTCATGCGACAGGCAGTTTGTCATCTAA

Transcript

OS493_003064-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZI87	Tubulin-specific chaperone D OS=Gallus gallus OX=9031 GN=TBCD PE=2 SV=1
Q8BYA0	Tubulin-specific chaperone D OS=Mus musculus OX=10090 GN=Tbcd PE=1 SV=1
Q9BTW9	Tubulin-specific chaperone D OS=Homo sapiens OX=9606 GN=TBCD PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003160 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_003064-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR033162 all species →	Family	Tubulin-folding cofactor D	Interproscan
IPR021133 all species →	Repeat	HEAT, type 2	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12658 all species →	BETA-TUBULIN COFACTOR D	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000226 all species →	Biological Process	microtubule cytoskeleton organization	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0006457 all species →	Biological Process	protein folding	Interproscan
GO:0007021 all species →	Biological Process	tubulin complex assembly	Interproscan
GO:0007023 all species →	Biological Process	post-chaperonin tubulin folding pathway	Interproscan
GO:0016328 all species →	Cellular Component	lateral plasma membrane	Interproscan
GO:0034333 all species →	Biological Process	adherens junction assembly	Interproscan
GO:0048487 all species →	Molecular Function	beta-tubulin binding	Interproscan
GO:0070830 all species →	Biological Process	bicellular tight junction assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K21767	TBCD; tubulin-specific chaperone D	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003064-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.9Max TPM

9.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.07	15.84
polyp at pH7 6	18	18	11.34	18.96
coral polyp · control treatment	16	16	10.30	20.18
coral polyp · oil and dispersant treatment	16	16	8.38	16.84
coral polyp · oil treatment	16	16	8.97	16.29
coral polyp · dispersant treatment	16	16	9.06	21.87
Polyp	10	10	7.62	17.90

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.84
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.24
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.71
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.40
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.94
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.73
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.45
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.24
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.17
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.42
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.39
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.96
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.79
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.18
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.29
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.41
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.12
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.79
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.76
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.02
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.22
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.18
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.74
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.26
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.59
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.43
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.98
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.73
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.27
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.30
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.22
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.07
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.02
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.74
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.81
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.96
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.25
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.17
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.58
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.57
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.73
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.09
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.95
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.33
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.59
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.87
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.58
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.22
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.78
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.86
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.34
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.07
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.41
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	17.90
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	14.05
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	9.46
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.17
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.49
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.81
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.44
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.20

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.