Gene detail

Detailed information of OS493_003092-T1 in Lophelia pertusa

Genomic Location: scaffold_6:5186244...5211949
NR annotation: KAJ7340349.1, hypothetical protein OS493_003092 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003092-T1

ATGGAGAAAGTGATTTACACGTTCTTTTTAGCGGAGATGTTGTGCAAATGGATAGCCATGGGTCTGTTTGGAAAGCTGGGGTATTTTGCCGAGTCATGGAATCGTCTTGATTGCTTCATTGTAGCTGCAGGGACATTCGAGTTGCTGTATAACAAGGGAGAATATTTCAGCGCTGTTCGTGCTATCCGGGTACTCAGACCTCTCCGCGCCATTAACAGAGTTCCAAGTATCCGGATCCTTGTGACATTATTACTGGACACGCTGCCCATGTTGTGGAATGTCCTGGCTATTTGTTTCTTTATATTTGCTATCTTCGGTATTGTTGCTGTGCAACTGTGGCGAGGGACGCTTAGAGGAAGATGCTTTCTTGATTTACCGCTGAACGTCTCAGGAGAAAGTTACAATTTGACAGACTTCTACGTCCCTTCGTTTGACAATCCCGACTTCGTATGTGCCATGGATGGCATCCCAGGCATTCAAATCTGCAACAGGCAGTCAATACCGCCATTGAAGCACCCGATATCTGGACGAGAGTGCACACTGAGCTATGAAGGATATCTAAACGAAACAAGAAGATCAAATAATTCCAATAATTGTGTCAACTGGAATCAATATTACAGCCAGTGCCGACAGGAAGGCGATAACCCTTCATGGGGAGCCATAGGGTTTGATAACATTTTTATTGCCTGGGTAGCTATATTTCAGGTGATCACGTTGGAGGGTTGGTCGGATATCATGTATTATGTTCAAGACGCCCATGGCTTGTGGAACTGGATTTATTTCGTTATTCTTATCGTAATTGCTTCGTATTTTATGACTAACTTGTGTCTAGTCGTCATCACAACACAATTTCAAGAAACTAAACAACGAGAAAATGAACTCTTACGCGAAAGTCGTCGCCGCGAGGGAACAAGCACTAGTACAATAGCGAGCAGTCGGTATGGAAAAGACGGCTGCTGGATTGAAATACTTAGGTACATTGAGCATTTAATAAGGAGGTTTAAACGAAAAATTCATAGACGATTTAACTGGAAATATTGCGACAGCGCCAATAAAAGGACGAAAACTTCGCGACACAGGAAACGGCGAAGAAGAAAAAAGAAACTTGTTTATCATCATCACCATCATCACCACCATCATCATCATTATCATCACCACGTGCATTGCACAGATCCCAAATGTAAGTGTAAACTTGGTCAGCAGTTTCCCGTTCATCCCGGGAGTGTGGATGTCACACCGAACGCGTCTTCTGTGGATGTTCAGCGGGTTCAAACCAAACGGGTCAAACCGGCTGGAAATACCCTGACTGTACCCGGACAAGTCCCGAATGCGGATAAGCGGGACAATGGTAGCGGAGCAGGGGCTGGGACGATACCAAGAATTTCTATTGTAACTGGATCCTCTTGTTCTGTGCGGAAAGAGCCGTCTTCGTCCGCGCATGGAGGCGAAATGATCACAAAAGCAACCGCAGCAGTGAATATTAACGGTAGATCCGCCGTGGCTGATATCGCAGCGCACACTTTCTTGTCAGCGGCTTCACTTTCTAGCGCAGCCGCAACGGCCACGGCCAGCGCCGCTGCGGCTTCAGCGATACATAACGTTTGCTCATGCGCAATGGAACACATGGAGGAAGGCATAAAGGTAGATTATGAGTCTGAATGTGTTTATGAAGAAGACGCCGGCAGTGAGAGCGAATTAACAGATAATGAAATCGACGAGGAGGATGAACAGCGCAAGGAGACGCCATGGTCACGCTTTCGTCGCGTGTGTCGTAGAAACGTGGAGAGTAAATGGTTCATGTTCGTTATCATGGGAGCCATCTTCCTGAATACACTGAGCATGGGCATTGAATATCACGGACAGCCTTTAAAGATGACAGAAGTGCTGGAAATTTTAAACTACATCTTCACGGCCATATTTGGCCTTGAAATGCTACTTAAACTGATGGGCATGGGTCTCTATGGATATATCAAGGATCTTTTCAACCTGTTTGACGGGTTCATTGTGATCATGAGCATCGTGGAACTATTTAGTGACGGTGACAGCAGTATTTCAGTACTGCGGTCTTTCCGTTTACTGCGCATATTCAAGCTGGTACGTTTTCTGCCGGCGCTCAGACGTCAGTTGCTTGTGATGATCCACACTATGGACAATGTCATGACGTTTTTGGCTCTGTTGTTACTCTTCATATTCACGGCCAGTATACTGGGTATGAACCTGTTTGGAGGCAAGTACATGTTCAAAGACGAGAGTGGAAATTATACCGCAGCACGTGCAAATTTTGACGACCTGTTCTGGGCGCTGGTAACTGTTTTCCAGGTTCTGACCCAGGAGGACTGGAACACAGTCATGTACGACGGAATGCGAGCTACTTCCAAATGGGCGGCGCTTTACTTCATACTCCTCATGACTATTGGCAACTACATACTCTTCAACTTGTTGGTCGCCATCTTGGTTGAGGGATTTGCCAATCAACCGGAAAAAGAAGGAAGCACTTGCAGTGTTAGATCACGATCTTCTCCTGGAAAGCACGACGGAGACTACGGGACGTGCAAAGATATGGCCCCGTATCCTATGATTACCCCACGGGTATGCGTGAGTCCCACAACATCCCATGACGACATGACAAGAGTGAATTGTAGGAAAACCGCTGAGCAAGTGCACCACATGCGCTGCTCATTCCCTTCTCTGTCGCCTAAATGTACACTATTTAGAGATGAATGTCACGCCTCAGCCCCAGTCTCCCCGGCCAGCACCTCGCCAAAAGTGCCTCGCAAGACCCTGTCATTTGGAGACACAACAACCATGGCTAGTGCGAGGGAGGATGATGTGGCGGTTGTTAGGATCCAGGACGGCTCGACATGCTGCTACAAGCGAAGGGACTGGTCTCTATATCTCTTTTCACCGTCCAACAGGTTTCGTAGATGGATGGTAACGCTGTACAGGAATAAGTGGTTTGATCGAGTGGTGTTGACTTTCATCTTATTCAACTGTATTGTTATGGCTCTTGAACGACCAGATCTGCCAAGCGACAGCACGATGAAGAAGGTGATTGACATCTGTATGTACATCTTCCTGGCAATCTTCACGATAGAAATGATCATTAAGGTGATTGCTCTTGGCTTTTGGTTTGGACCTGATACATACTTGCGCAGTTCGTGGAATAAAATGGATGGCTTCCTGGTGGTCGTGTCCTGGATTGACGTCATTGTTTCCCAGACAACCGACACGCAAAGCTCCATTCTTGGCGTGCTACGCGTGTTTCGAGCGCTAAGAACACTCCGACCTCTAAGGGTGATCAGTAGAGCGCCTGGTCTGAAGATTGTCGTGGAGACGTTAATATCTTCATTAAAACCGATTGGAAACATCGTGCTTATAGCTGCGACATTTTTCATCATCTTTGGCATTCTTGGCGTACAGCTGTTCAAGGGAAAGTTCTATTATTGTAAGGACGCAGAATACCCTACAGTGGTCGAAAGATCCGACTGTCAACAACATGGCTACACCTGGGAGAACAAGGAATACAACTTTGATAACTTGGCTAAGGCACTGTTAACATTGTTCGTGTTTTCCACCAAAGACGGCTGGGTGACCATAATGTATGATGGGATAGATGCTGTTGGCATTGACAAACAGCCAATAAGAGACAACAACAAATGGAACGTTTTGTTCTTTGTGGCATTTTTGCTGCTGGCTGGGTTCGTGGTGCTGAACATGTTGGTTGGAGTAGTTGTGGAGAACTTTCAGAAGTGCCGAGATTTGATAGAGAAAGATCGCGTGGCAGAAAGAGAGAAAAAGAGAGCTCTAAAGCTCCAGTCAGAAGCTGACAAGGAAGAGGCCGAAGAATTCCCACAACCTCGGCGGTTTTTCCACCGAATCTGTACACACGGGTACTTTGATCTCGCAATATCAGCTGTTATCGTCCTAAATGTCATTTGTATGGCTATGGAGCATTATAATCAACCCGAGGAAATGAACGTGTTTCTAAAATATGCCAATTACGTGTTTACGGCTATCTTCATCGTTGAAGGCGTTTTAAAGATCTACGCTTTAGGATTCAGGAAATACATCAGAGAAAGGTGGAACCAGTTGGACTTGCTCATCATTTTGCTCTCAATTGTCGGAATTGTTCTGGAAGAAATGAATTCTCAACTGCCAATCAACCCGACTATCATCCGGGTCATGCGAGTGCTCAGAATCGCTCGAGTGCTTAAGCTGCTGAAGACAGCTGAAGGAATCCGAAAGTTACTTGACACTGTTGCCGAGGCTCTACCACAAGTTGGAAACTTAGGTCTTCTGTTCCTCTTGATGTTCTTTATCTTTTCCGCCTTGGGGATGGAACTGTTTGGTCAAATTGAATGCACGGACGATATACCATGCGAGGGACTGGACAAGCATGCACACTTCAAGAATTTTGGCGTTTCAATGTTGACCTTGTTTCGAGTATCAACTGGGGACAACTGGAATGGAATCCTCAAGGATATCATCAACAAGAAGCGCTGTGAACTGGATCCCAAGCCAGGCTGCACCGCGCTGGAACACATCGCTCCCATCTACTTTGCAATCTTTGTCCTTGCCACACAGTTCGTCCTACTGAACGTGGTAGTTGCAGTCTTAATGAAGCACTTGGAAGAGGCCAAAGAAGAAGATTCTATGAATTCGTCACGGGACGGCACAGATACTGTACTAGCTATGCAACTGGACGGCAACACAGGCCTCGACACCATGCAGGGACATTCTTCCAAAGATGGCTATCCGGGAGGGAGTGGGTCAAAAACGGAGTCAAACAACAACGCTATGGTGGTGCTTCCTGTTGTTGGCTTAGTTCGCCAATCGAATGATTCAGATAGCAGTTTGAGTTCTTTTGAACAAACTGTACAACCAGTGCGAGCCAGCCGTAATTTGAGGCAGCGGCTTCCGCCAGTTGATCAAGTGCAACCCGAGAGGAGCATGAGCCTTGCTACCTTGCGACTTCCGCCGATAGGCAGCCAATCAAGTGGCCTTAATATCGGTGGAAGGTCGGCGAAAAACGATGGTTCATCGATATCGGGATTTTCCAGTCCCGAGAATGAAAAGGCTGTCAAGAAACGAATGGATGGCCAGATATCCCCACGTGCTCCCATATACGTCATGAGTGAGGATAGTGACTTGAATGACAGCAATGTGGAAGTTGACCATGACCACAGTGTAGTATTTAGGCCTGTTGACAGAGATGCTAAATCCAAAGGATCAGTGCGCTCGCCTTCACCCCAATCAAGTAGTGAAGATGAAGGGAAAAAGAAGAAATTTTATTTCAAAAAGCCTTCTCACAAATCAGAATCGACAAAGGGGAAGGCTTTCAAGAAAGAACCCAAGTCGACTTCAATCGTGTCACCAGAAAGTAAACCAGTTAAACAGGGAGCAAAACCGGTCAAACCTGAGGCTCGGTGGGCTTCTCCAGTATTAGGTGTAAATCAAGGCAAAGTAGAAATGAAACTACATGGAACAAAAGCAAAAACTGACAACGTCGATCAAGACACGAGCCATCAAATGCAAAGTTACGTGTGA

Transcript

OS493_003092-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O95180	Voltage-dependent T-type calcium channel subunit alpha-1H OS=Homo sapiens OX=9606 GN=CACNA1H PE=1 SV=4
O88427	Voltage-dependent T-type calcium channel subunit alpha-1H OS=Mus musculus OX=10090 GN=Cacna1h PE=1 SV=3
Q9EQ60	Voltage-dependent T-type calcium channel subunit alpha-1H OS=Rattus norvegicus OX=10116 GN=Cacna1h PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001282 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00520 all species →	Ion_trans	Ion transport protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005821 all species →	Domain	Ion transport domain	Interproscan
IPR043203 all species →	Family	Voltage-gated cation channel calcium and sodium	Interproscan
IPR027359 all species →	Homologous_superfamily	Voltage-dependent channel domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10037 all species →	VOLTAGE-GATED CATION CHANNEL CALCIUM AND SODIUM	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005216 all species →	Molecular Function	monoatomic ion channel activity	Interproscan
GO:0006811 all species →	Biological Process	monoatomic ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0001518 all species →	Cellular Component	voltage-gated sodium channel complex	Interproscan
GO:0005248 all species →	Molecular Function	voltage-gated sodium channel activity	Interproscan
GO:0005261 all species →	Molecular Function	monoatomic cation channel activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0008332 all species →	Molecular Function	low voltage-gated calcium channel activity	Interproscan
GO:0043005 all species →	Cellular Component	neuron projection	Interproscan
GO:0070509 all species →	Biological Process	calcium ion import	Interproscan
GO:0086010 all species →	Biological Process	membrane depolarization during action potential	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04855	CACNA1H, CAV3.2; voltage-dependent calcium channel T type alpha-1H	-	Ion channels	ko04040	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003092-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

55.7Max TPM

18.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	23.35	53.35
polyp at pH7 6	18	18	13.05	18.48
coral polyp · control treatment	16	16	23.76	55.69
coral polyp · oil and dispersant treatment	16	16	13.26	23.94
coral polyp · oil treatment	16	16	18.48	31.78
coral polyp · dispersant treatment	16	16	13.75	28.89
Polyp	10	10	25.89	54.46

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.35
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	51.91
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.75
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.57
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.16
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.14
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.01
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.94
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.27
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.16
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.98
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.70
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.48
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.23
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.57
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.22
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.05
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.22
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.05
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.31
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.66
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.41
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.24
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.94
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.57
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.91
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.56
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.23
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.69
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.98
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.41
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.74
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.14
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.70
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.86
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.84
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.79
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.33
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.49
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.52
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.91
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.54
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.94
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.44
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.82
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.53
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.32
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.26
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.09
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.79
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.81
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.20
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.49
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.09
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.57
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.78
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.08
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.73
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.95
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.61
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.73
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.87
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.47
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.84
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.62
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.02
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.89
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.56
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.95
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.04
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.18
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.26
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.78
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.37
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.60
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.45
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.23
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.55
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.35
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	54.46
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	35.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	31.75
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	31.46
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	29.14
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	28.36
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	14.75
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	14.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.22
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.76

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.