Gene detail

Detailed information of OS493_003106-T1 in Lophelia pertusa

Genomic Location: scaffold_6:5418636...5428517
NR annotation: KAJ7340362.1, Src kinase-associated phosphoprotein 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003106-T1

ATGGATCCAGTTAACAAGGACGTCAAAGAGGCTGTGTGTGAGGCTGAAAAGTTTTTTTCTGTTACATTGGCCCAGGAGAATCTATCTCCAGCAGCAGAAAAGGAACGCAGCTTGCTAGCAGATAGGTTTAGGAAGTTGAAAATAAAACTTGGCTTCCAGAATGATCTCCCTGGTGGCGGCAAAGCACCACCACGCCCACCAAAGGGTGGGGTACCTATTCCTGCACCTGAAGCTAATGAAGACCAGGGTGGAGAGGAACTGTATGATGATGTGGCAGCTGAAATTCCACAAGATGACTACTGTGAGATGGACCAGAATGCTGAAGAAAATCAGGGTCAGTCCCAGTCAGCAAATGTAGATACAGCAGGTGAGAATTACGAGGTCATGTCAGCAGAGCCGGGCGATGGAGCATCACAGGGCGGTGAAGCAGCTGGGGAGGATTACATGGCGATGGAGGAGGAAAGTCAAGATCAAGAAGATTATGAAGAGCCTCAACAAGAAAACACTGGTAATGAAGATTATGAAATTACTGAACAGCCTCCTGCACCACAGAGTGAGGATTATGAAGTGCCAGGTGTTGACTCAGATTATGAAGAGGCAGACCAATCTACATCATCAAACACTGCTCCAGTTGAGGCTGACGGCGGCATGTATGAAGGTGTAGAATCAGCGCAGACAGTCAACGAAGGTGAAGGGTCAGTTGATGGTGTAAGAAAAGACAGGTCAGAGACTGTCAACTGGGAACATTTGACAAAGAGTACTAAAGTTGAGAACATTGAAGGTGTTATTTTACAAGGTTCTATGAACAAACGTCGCAAGGATGGCAAGATGTATCTAGGGAGTAAGTATCAGAAACGCTACTGTGTCGTGCGTAACCATGTGCTCTACTACTTCACTAACAAGAAAGCGAGCAAGCAACAAGGACACATCTTGTTGCCAGGTTATAAAGCAGAATTCGCTAACAAGAAGGGACGTGAGTTTACTCTCGCGCATTCAGAAGGACACAGGACTTACCAGTTTGAGACCAACAATAAAGAGGAAACAGAGAAGTGGATGCGAGCAATACAAGCCGCTTGCGATGCTCCTATGTCGGATCGTCACAATGCAGATCTAGTTGAACTGCGCAACAAACAGCCCTCGGGTGATGAGGACAGCTTGCACTATGTTGACGCAGAGCAGTCTAATAAGACTGACGATCCAGCGGATGAGATGAATGGCGATGTTTATGATGATAATATAAATGAAGATCTGTACGAAGAAGTCGGTAGTGTTCAATCGTCTGTCTCGAACCAGCAGTCGCAGCCGATACAGGAGGTCGACTATGAGATTTCTGCCACACTGGTCACTCCAAAGTCAGCTTCAAGTCCTGCTGAAACTTCTGCAGTTCAACCAATAGATGAAGAGAATTATGAGCTTCCGGAGCATTCACCACCTCCCCCTGCACGACCCACCAAATCACAACCCAAGCCACCGGAAGTAGACACGCCTCCAGCACCCCCACCCCCTCGTTCTTCAATACCACCGTCACCCACTCCTCCCACACCGGTGCAAGATGACGTGTATGAAATTGCAGACAGTCCTGACGATACCCCAGACTTACCACCACCCCCAGCGCCTATGATACAAGACGAAAATTACGAAGTACCGGGAGAAACTCCTGCCCCACCCCCCGTGCGGCCTCCCAAATCTTCTCGACCCCACACAACACAGTCGTCAAATGGCCCTCAAACAGCGCCACCAGAAAAGCTTCCCGAACGACCTGCTACTAAACAGCCACCCGTTGCACCGAAACGAAAGGACGAGCTTCCTCCACAGAGTCCTACAGGAGATCAACAGAACGAAATCAATTATGCAAATGTGTATCAAGCTTTGTGGAATTGTGACGCCAGCGATAAAGACGAGTTAGGATTCAGGCGAGGTGACCTCATTTACATTTACGAAAAGCCGCATTGTGATTGGTGGATTGGATCGTTGTTTAAACCTCAGGGATACAGCGTGGGCCTGGTGCCGAAACAGTATGTGATGGAGGCGTATGAATTATCCGCGTGA

Transcript

OS493_003106-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q32LP7	Src kinase-associated phosphoprotein 2 OS=Bos taurus OX=9913 GN=SKAP2 PE=2 SV=1
O75563	Src kinase-associated phosphoprotein 2 OS=Homo sapiens OX=9606 GN=SKAP2 PE=1 SV=1
Q5RDS2	Src kinase-associated phosphoprotein 2 OS=Pongo abelii OX=9601 GN=SKAP2 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004378 (this species only)
Ubiquitin family	UBD\|Other\|SH3 · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14604 all species →	SH3_9	Variant SH3 domain	Domain	Interproscan
PF00169 all species →	PH	PH domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001452 all species →	Domain	SH3 domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR001849 all species →	Domain	Pleckstrin homology domain	Interproscan
IPR037781 all species →	Family	SKAP family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR15129 all species →	SRC-ASSOCIATED ADAPTOR PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23471	SKAP2; src kinase-associated phosphoprotein 2	-	Yersinia infection	ko05135	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003106-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

42.5Max TPM

15.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	7.95	15.76
polyp at pH7 6	18	18	6.98	13.62
coral polyp · control treatment	16	16	23.58	37.64
coral polyp · oil and dispersant treatment	16	16	25.40	42.51
coral polyp · oil treatment	16	16	16.58	31.17
coral polyp · dispersant treatment	16	16	19.51	33.80
Polyp	10	9	3.23	7.46

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.19
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.70
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.57
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.79
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.49
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.76
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.39
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.64
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.60
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.27
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.62
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.26
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.54
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.18
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.76
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.09
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.86
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.51
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.02
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.81
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.70
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.38
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.52
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.12
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.04
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.13
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.60
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.17
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.55
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.33
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.56
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.99
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.51
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.40
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.19
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.31
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.06
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.96
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.88
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.83
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.64
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.74
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.49
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.17
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.80
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.65
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.58
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.79
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.65
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.99
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.99
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.60
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.32
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.16
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.54
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.80
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.16
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.07
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.90
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.20
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.12
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.26
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.24
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.16
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.73
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.46
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.23
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.89
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.49
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.95
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.15
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.