Gene detail

Detailed information of OS493_003165-T1 in Lophelia pertusa

Genomic Location: scaffold_6:5939333...5951524
NR annotation: KAJ7340419.1, hypothetical protein OS493_003165 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003165-T1

ATGCGCTGGACTGGTGACTTGTTTGTCGCACCCGCTGATCTCGAGTACCCTGCCATGAAAAACTCCAAACATGTTTTATCAGAGCCATATGGGACAGCAACCGATAAAGCTCTTTCTAAACAGATTGTACCCTTGAGAGGCCACAGCCAAACACCAGAAAAAGCTACCCCATTCCATTCGACAGATGGGAAGTTTAAGTCACCCCAGGGAGAAATGGAACACCCTGGGGCGAGGACGGCAAATGTATGCGATGGAGAACCGGACGGAGACTATATCGACGCACATAACCCATACGGTTATATAACCTGCCTGGGAGCAAATGTATGCGATGGAGAACCGGACGGAGACTATATCGACGCACATAACCCATACGGTTATATAACCTGCCTGGGAGGTCAGACATACCGCAAGAACTGTCCACCTGCAGCAGAGGGAAAAATCAATATCTTTAGCGGCACCAAGCTAAGGAAGGAAGGTAAGGTTGTTGCAATGCAGATCAAAGATGTGCATGTTATTCTTCATGTGCTGGTGACTTGGTTTATTCAAAAGAGTGTTGGAAAGCATCTTCTCGTCGGTTACTGGGGGCAAAACAGCGCAGGAGGAAAGTTTCCTCAGAATCCAGAGAAAGACCTCAAAGATGTCTGTGCAGAGAGGAAATACGATATTATAGTGATTGGATTTGTGGTTACATTCTTTGGCAAAAACAATAAAGATAAAATGCCAGAGGTGAATTTTTCCCGACACTGCTGGGATCCAGCGTCACCAGCGCACCCAAACCTTTACAAGTGTCCCAAAATTGAAGAAGGCATCAAAGCTTGCCAGCAGGCAGGGAAGAAAGTTCTCATCTCGCTTGGAGGAGCCACAGGAAATAATGATCTTCAGGATGCTCAAGCGAATGTTCTTGCTAAAAATCTGTGGGATTTGTTTCTTGGTGGAAAGGATAGGCCAAAGATAAGACCATTTGGAAGTGCAATTCTTGACGGAATCGATCTGGACATTGAAGACCACAAATCAGGCGGCTACGCTCAGCTTGTCAAAAGCCTGCGGCAATTGGAAAAAGCAGGGGCCAAAAAGTACCTCATCACAGGGGCCCCTCAATGCCCATTCCCTGATGCTTCTCTGGGCCCTATACCGGGCACTGCCTTGGGGGACCAGGGTGGGGAGTTTGATCACGTCTATGTGCAGTTCTACAACAACTTCTGCCACACCGGTGACGAAGCACAATTCTATCCAAATATGGATAAATGGCTTCAATTTGCAGCGACCGCTGGTCAGGCAAGGGACATTTCCATGGTATTGAAGAACCGGAAGAGGACTATGGGACGGGGCCCCAAGATATTCGTGGGGATGCCGTCCGCTACCGGGGGTGCGGGAGATCCAAAGTTCTACAGGACACCAGAGGAAGTGGCAAAGATTTATGAGAAACTGAAGAACAAGCCAAACTTCGGTGGATTCATGTTATGGGATGTCGCCTGGGATCAACAAAATGTCATCAACGGCAAAGTATACAGCGACAACATTGCAGATATCACTGGTACGGGTGGCCCTGAACCTACAACAGGAGCTCCAACAACTCCTGGACCCGGAGCTTCCTCGACACCAGGTGGATCGTCGACTCCGGGGGGATCTGCGCCCACTACTCTACCAACCCCTGGGGGATCAGCGCCTCCGACGACACCCATGGTGCCCACAACCCCTGGGGGATCTGCGCCTTCCACGACACCCATAGTTTCCACTACTGTACCTACCCCTGGGGGAGGTGGAGGTGGAGGTGGAGGTTCTGATGATTTCTGTAAAGACAAAGAGGATGGCGACTACGCAGACCCGGATAACCCCTCGGGTTACATTAGCTGCTCGGGAAAGATCACGTACAAGAGGCCTTGTCCCGCGGGACTTACGTGGAACGCGGATAAAAAGTACTGCGACTGGCCGAGTAACGTGAGAAAATATCAATCCCACGATGCGAAGCGACCTGTGCAACCGCAGAGAAAGATAAAGAAACAACATGGAATACAGCCGGAGGTGGTTATATAA

Transcript

OS493_003165-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P29029	Endochitinase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=CTS1 PE=1 SV=2
P40954	Chitinase 3 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) OX=237561 GN=CHT3 PE=1 SV=2
P29027	Chitinase 2 OS=Rhizopus oligosporus OX=4847 GN=CHI2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001026 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01607 all species →	CBM_14	Chitin binding Peritrophin-A domain	Domain	Interproscan
PF00704 all species →	Glyco_hydro_18	Glycosyl hydrolases family 18	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002557 all species →	Domain	Chitin binding domain	Interproscan
IPR001579 all species →	Active_site	Glycosyl hydrolases family 18 (GH18) active site	Interproscan
IPR050542 all species →	Family	Glycosyl Hydrolase 18 Family Chitinases	Interproscan
IPR001223 all species →	Domain	Glycoside hydrolase family 18, catalytic domain	Interproscan
IPR017853 all species →	Homologous_superfamily	Glycoside hydrolase superfamily	Interproscan
IPR036508 all species →	Homologous_superfamily	Chitin binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45708 all species →	ENDOCHITINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005576 all species →	Cellular Component	extracellular region	Interproscan
GO:0008061 all species →	Molecular Function	chitin binding	Interproscan
GO:0004553 all species →	Molecular Function	hydrolase activity, hydrolyzing O-glycosyl compounds	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0004568 all species →	Molecular Function	chitinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003165-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003165-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

99TPM > 0

7Conditions

13.1Max TPM

1.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	1.08	2.15
polyp at pH7 6	18	14	2.54	13.13
coral polyp · control treatment	16	15	1.36	5.70
coral polyp · oil and dispersant treatment	16	15	1.15	6.33
coral polyp · oil treatment	16	15	1.18	3.54
coral polyp · dispersant treatment	16	15	1.43	8.47
Polyp	10	9	0.85	2.82

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.90
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.34
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.21
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.11
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.73
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.31
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.13
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.97
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.19
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.50
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.81
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.00
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.50
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.72
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.45
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.37
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.35
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.34
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.70
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.68
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.24
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.99
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.64
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.57
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.32
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.23
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.21
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.33
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.74
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.40
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.11
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.88
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.86
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.76
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.29
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.25
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.14
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.11
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.54
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.68
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.54
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.36
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.86
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.69
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.65
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.41
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.36
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.47
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.35
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.45
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.78
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.66
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.30
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.17
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.55
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.85
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.71
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.52
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.15
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.