Gene detail

Detailed information of OS493_003225-T1 in Lophelia pertusa

Genomic Location: scaffold_6:6594524...6618545
NR annotation: KAJ7340476.1, AP-5 complex subunit zeta-1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003225-T1

ATGTGGAACCTCCTGTGGAGCAGAAAAATATACCAATCATTATGCCTGTGGTGTGGGTTCAGGGTCAGGAACAAGGTCACTGGGCAAAATCATGTTCCACAGCTTGTCCAATGGCTTACCAAACCTGGGGTCCCTGTGGAGCTACAGACATTGTCGCTTGGATCTTTACAGTTATTGATACACATAGATGACAACATCATATCACAAGATGACGCTGGTGGAGTTAGTCGGCAAATGGCCAACTGGTTAAAAAATGCCAGCACTGTGTCAGCACCAAATCCTTATCAGAGACAGATATTCAGAGGAGGAAAAGCAAAGGGGTATCAGCTGGTCACTGAGGTTGATGGAACATCATCAAGATATTTCTTTACAGTGCTGAGTATTGCACAGTACTGTTTTCCAGACCAAGTTTTGAATGTCTACAGCTTTTCTATGTTGCGATCATGGCTTCAGCATCTCACATTTACCAGCACAAAGTCAAATTCTGCTTCTCCGAGAGATGGTCCTTCACCTCTGATTTTTGCAACTCCGTCAAATTCCAGCTCCGTCGAGAATCTCAACCAATCAGCTTATCCGTATGGATCTCCGTCCCATAATATCCTTAATCAAAGTCAATCAAGTATGGATAATGTCTCCATTGGTTCCCAGTCTTCTACTGGGTTTATTATCCCGCTGTCACGCTCCTCTCCACAGGAGTCTGAGAACCGGTCCTTGACCCAGTCCCCCATTCTTGGAACATCTCCTGATGAGCATTCTTTGTCAAGTGGCAGTGACTCTAGACCCCAGACTCCTTTAAGCTTTCCACTTGATGTGGAGGAGACTGGTGTCAAAGCTCAGCCACAACCGGCAGCAAAGCGAGGAAAACATCAGAGATCTATGTCATCATTAAGTTTTTCAAAAATGTTTCCTTCAAGTTTACATGGCACAAAAACTGGTGAACAAGAACTAAAGGAAAGAGCTTGTGAATACTGTCTGAGGCTTCTGGAACAAAGTGAAAGGAAACCATGCAAGCAACAAGATGTCATGTTAATTGAGGCATGTCTCGTTGAAGCCATCTACAACTTGGACATCCTATGCTCTGCAGACAAGTCGTTAATTCCTAAACTTATTGAGATCATAAGAAGACTTTATGCTCGAGTCACATCTGATGTCAACAGGTGGAAAAGAGTTCTGATTCCTGTAGTACAGTTCCTCCTTAACCATGGTGAAACAGTTGTCTTTGATCCTGAACCTGCCTGTAAAACTCTCCTGGGTCCTGTGCTAAGTTCCTATTATGCCAATTCTTCCCTCGCGTTTGATATTATTTTCTTTTGCCTGGAAAACGTGAGAAAACTCTGCATATCAACCACCATTCTTTTGAAGTATTTTCCAAATTTATTCAAGATCCTGGCATGGCAGCCACGTACATATGTCAAAGAATTCATGGACATGCTGCCCGCCATGCTAAATGAGGACACTGCTGTTGAGATGTTTCACACACTGTTGGATTTACCTTGCTTAGCTGCCGCTTTGTTTTTCGTACCTCTTCGGGCCACTAAAGGTACAAGGCCGAGACAGGGAGACACCATAGACAGACTTGCAACACTTCATTCTTTGTTAGAAGACAGGCTGGAACAACCTCGTGTTGTTGTATCTGCGCAAATTGCTCCGGTTTTATTGAATGTGATGTTTTCCACCATTCTGGAAGAAGCAGACGAGGAGACAGCAAGTCGTATGATCCCTGTCATACTAGAGAGAGTTGGACTCCTGTATCCTGTACAAAACTACCACAAAGAGATTCACGAGTTGCTGTCAGAGCGGCTTGTACAGTTGTGTCAGAAATATCCAAACCTGATTGTCAGGTATCAACAGGATATCATGGACTTTGTTAGCGGACTGAAGAACCTGGGGCCAACAAAAGAGAACTTTTTCGTTCACTTGGTGTGGGTTATAGGCGAGTTTGCCTCATCAGCGCATGACAGTGGATGTACCGTACAAAATATTGTGCAATACTTCGAGGCTTTTGAAGCTTTAAGTTATGAAGTTGTAATGCAGAATGCACCGGGAAAGGTTTCTTTCAGTGGAAGACTTGTTTCAGTTCTAATGACAACGTTGGCCAAGCTTGCATCAAGATGTCAGGATGTAATGCAGAGGGCTATTCTATGCTTGAGTAAAGTAGTGCGACAGAAACCAGAGCTTCTTTCAGACCCAGAGTGTTACCCAGATCTTCTGATGCGAGCCCAGGAACTAATCAACCTTCTAAAACTACCCAACGTGGCTCCTGTGATACTGAGCCCAGATTCAGAAGTTACAGCGGAAGGTGGCACAGAGACCGAAACTCGTCTTTACCTCTGCTCCTTCGCACTTGTGACACAATTCTTGCTTCGTGAATTCAAGAGGATTACGGGATTTTCACCAAGCTTGGGAAACTGTAGCCTGTTTTTTATTGTGATCCGTGAAGCAACAGTCTATTTCGCCATTTTATGGAGCCATGATCGCAAGAACAAAACAAGTGGAAACTCAAGTGGAAAATTGTTTTTGGATGAAAATGTTTTCCTTCAAAAAGTTCAAGTTAAGCAAGCGAGAACAGTTGTGAGACTTAAGGAATTTAACTGCAGAATGCCTGGTCACTTATTTGCACTAAGAATAGCGACTGTTGTTTTATGCCTCGTTCTACAAAGCACTCCGACACAAGAAAAATGA

Transcript

OS493_003225-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q3U829	AP-5 complex subunit zeta-1 OS=Mus musculus OX=10090 GN=Ap5z1 PE=2 SV=1
O43299	AP-5 complex subunit zeta-1 OS=Homo sapiens OX=9606 GN=AP5Z1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005513 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14764 all species →	SPG48	AP-5 complex subunit, vesicle trafficking	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR028222 all species →	Family	AP-5 complex subunit zeta-1	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46488 all species →	AP-5 COMPLEX SUBUNIT ZETA-1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0044599 all species →	Cellular Component	AP-5 adaptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19025	AP5Z1, SPG48; AP-5 complex subunit zeta-1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003225-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

22.9Max TPM

6.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.41	8.11
polyp at pH7 6	18	18	6.59	9.26
coral polyp · control treatment	16	16	6.30	12.97
coral polyp · oil and dispersant treatment	16	16	4.33	11.36
coral polyp · oil treatment	16	16	7.10	17.21
coral polyp · dispersant treatment	16	16	4.46	9.59
Polyp	10	10	11.71	22.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.11
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.73
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.82
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.58
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.45
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.23
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.96
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.82
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.79
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.00
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.64
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.52
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.84
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.14
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.42
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.59
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.37
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.97
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.91
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.50
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.12
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.25
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.96
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.81
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.74
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.36
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.12
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.12
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.36
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.44
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.22
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.65
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.53
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.99
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.83
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.48
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.09
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.98
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.43
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.94
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.21
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.99
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.38
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.53
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.65
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.60
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.01
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.91
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.50
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.92
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.96
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.51
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.49
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.29
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.95
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.32
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.22
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.91
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.73
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.94
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.92
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.15
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	22.89
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	18.95
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.05
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.84
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.76
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.71
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.57
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.54
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.83

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.