Gene detail

Detailed information of OS493_003461-T1 in Lophelia pertusa

Genomic Location: scaffold_7:1734302...1747483
NR annotation: KAJ7393799.1, WD repeat-containing protein 7 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003461-T1

ATGTCTTCATCCTCTGTAGTTCCTGTTGTTTTGTGGGGAAGTACACCTCCTTCACATTGCATCTCGTGCATCATAACCACTTATAATCAGAAAACAATCGTTACTGGATCTACAGATGGACAGTTGGGAATCTGGGACCTACGGTTCGCGGACGATGGAGAGATCAAAATCATTCCAAGGAACCTGATATTTGCGCATTCAGCAAAAGTTACAGCACTTGCAAAAGCTACTGATGGATGGGATAATCAGTCCAGTATTATCAGTGCAGCTGATAATGGAGAGCTGTGTTTATGGGATACAGATGATGGAATCTGCATACAAACTAACGTCATTGCTGGGATGCATTTAGCTCTATTGTCTTTTCATGTAACTATTGGCACTGGAAAAGAGTGGCGTGTTGTTTGCTATGGCAGCTATTCTGACATTTATGTCCTTGATGCCTTGTCGCTTGAGGTGTTGTACACTCTGCGATCACCATCTGCTACTAATTGGATCAGTGCGGCATGTGTTGTGAGGCCTGCAAGGAGACCAGAGGATGTTGTGGTTGCGGTATCCCTGTCTGGTATGCTTAATATCTGGATGCTGAAACCAAATGTTGATTCAAAGTACAGTGAGCCCACATATGAACAAGAGTTGAAACAAGTTACAAACAGCAAAGCTACAGGGATTTGTTGTAATCCTTTTACACAACGAAGCATTCTTGTTGTATGTGCAAGAGAGTGGCTGATTTATGATGCTGGAGACTTCAAATTCCTGACAGCAGTTTCCAGTCCTCCCAGTCAGAACTGGATGGGAGGAAACTTTGTCGCAGCAGACTGTGTTCTAATTTGGAGCAGGGATGGAAAGAGCTACTTGTACAAGCTTCCTGCCTTATGCTGCCCTGGCTTTCAGGACCAAAACCAAGGTCAGTTCAAGTTCTATCATGCGATCCTTTCAAGGAGCCAAGAATCATTCAGGTGTTTGAAAAAACAAGTGAACAGAGCGCTGTGCCCGATTTTTGATCCAGCCATGTTTTTCTCGTATGGACGAAGGGGACCTTACTACAAGCTGCTGTTAAGAGGTGGATCAAATGGAAGTGTCAGTGTGTGGAAGCTGAATGATGATCTAGTGACGTCAACTAAAGCTTATGATGCCAATGCAACTGGTGTTGGTCCTCTAGTATCGTGTAGTTACGCAGACTGTTGGGACACAACATCGACGCCCTGTGGACTGATTGACTCTTTAGATGATTGTGGACAAGCCATTCCTGTAAGCGCCTCGCTGTATTTACCTGCTCAAGACTGTATCGTGTGTGGCCGGGAAGATGGTTCGATTGTTATTATATCAGCGGCCAAGGCGGTCATCGCTCAGTTACTTCAGCTCCCAGGCTCAGGATGGCCAGCTCACAGGGTGCTCTTAGGACACAAAGGCCGAGTGACCTGTTTGCTGTACCCTCACGATGAGTACCCTCGCTATGACAGGGAGTTTTTGGTATCAGGTGGAGCTGACTTCTCTGTTAAACTGTGGGACATCTTTACTGGAGACTTGCTGTACACGTTTTCTACTCACGGAGGAGAATTGCTTCGTCTTACTTGTACGCCACCTGATTGCAGTAATCGCGTCCAATCCTGTATCTGCTCTGTAGCCCAGGACCACTCGGTTGCATTGTTGGGACTGCGCGAGCGGAAGTGCATTATGTTGGCTTCTCTTCACGCATTTCCGGTGGAGACGATAAAATGGCGAGCGCTGGATGACTTTTTGGTCGTAGGCTGTACTGACGGTTCGGTGTATGTATGGCAGATGGAAACAGGTCATCTAGATCGGTGTGTGAGTGGACAAGTTGCTCTGAACATCTTAGCCGCGTGCGATGAAGAGAAGAAATCCAGCACAGCCAGCGTTCCTTCCAAGGCTAAGAGCTCTCTTGGACGGAAGATCAGCCACATTACATCCACCCTGCCGACTAGTGCTGCTTCGGCTGCAGTCAAGAAACTCAGGAAGAGCTCCAACCAACAAGCCTCGCAAAGTCCTTCATCCTCGCCAAGACTATCTGGTGCAGGTGCAGAGGGTTATGGTGAGGTGTTATCCGGTGGTCCGCTCAAGGTCATGTCCACCAAGTGTGGCGTGAGAGATCCAGAAATACAAGTGATTATGTTTGATATCGAGGCGCTGATATGCAACTTATTAACCGAAGAAAAACCCTCTACTTGTTGGTAA

Transcript

OS493_003461-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y4E6	WD repeat-containing protein 7 OS=Homo sapiens OX=9606 GN=WDR7 PE=1 SV=2
Q920I9	WD repeat-containing protein 7 OS=Mus musculus OX=10090 GN=Wdr7 PE=1 SV=3
Q9ERH3	WD repeat-containing protein 7 OS=Rattus norvegicus OX=10116 GN=Wdr7 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003336 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR049916 all species →	Family	WD repeat-containing protein 7/72	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR011047 all species →	Homologous_superfamily	Quinoprotein alcohol dehydrogenase-like superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44099 all species →	RABCONNECTIN-3B, ISOFORM A	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003461-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003461-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

20.9Max TPM

10.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.33	12.06
polyp at pH7 6	18	18	7.61	11.67
coral polyp · control treatment	16	16	14.05	20.88
coral polyp · oil and dispersant treatment	16	16	11.70	16.82
coral polyp · oil treatment	16	16	11.75	19.01
coral polyp · dispersant treatment	16	16	10.45	17.43
Polyp	10	10	4.52	7.83

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.06
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.24
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.52
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.85
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.64
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.16
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.74
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.69
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.55
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.71
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.89
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.79
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.58
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.57
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.67
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.07
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.29
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.24
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.53
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.58
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.46
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.07
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.30
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.03
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.63
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.05
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.88
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.15
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.34
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.73
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.54
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.69
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.79
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.68
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.18
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.94
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.17
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.82
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.02
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.39
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.93
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.57
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.97
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.79
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.74
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.09
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.04
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.93
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.90
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.80
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.03
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.99
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.20
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.74
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.65
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.55
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.55
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.52
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.43
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.45
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.81
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.67
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.20
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.96
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.55
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.69
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.58
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.54
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.96
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.23
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.92
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.26
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.54
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.72
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.47
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.56
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.83
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	6.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.85
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.85
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.58
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.23
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.98
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.85
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.