Gene detail

Detailed information of OS493_003489-T1 in Lophelia pertusa

Genomic Location: scaffold_7:2200997...2213147
NR annotation: KAJ7393823.1, hypothetical protein OS493_003489 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003489-T1

ATGAATCAGTGGAAAGCATTGCTTGATCTCATGGCAAAGAGACCCAACTGTGGGTGCTGTTTTGTGAAGGACGCATCCCTTAGGGGTTGGGCCCATCGTCTGGGTACCAAATCTTTGATTAATGCAATTGGACACTGGTTCCAAAAGGTGGCAAATCATGTTCTTGGATCTGTTCTGTGTTCACCTGGCTGTTTCAGTGTTTACAGAGCCACTGCAGTCCGGGATGTGCTTCCCATATATTCAACCAAAGTTGACAACTCATTTGATTTTCTTACCAAAGACATGTCTGGCTGGCGGTTAGAATACTGTGCAGCGGCCGAGGATAGCACCTTCTGTCCAGAAAATTTTGACGAATTCTTCAAGCAGAGACGGCGTTGGATTCCATCTACTTTAGCCAATCTTGTGCTCCTGATCAGTGAATGGAAATTAACAGTGGGCAACAATGACTACATTTCATTTCCATTCATTCTCTACCAGGCACTGATGGTTTTCTCGACGATTATTAGTCCTTCCACCGTGATCCTAATCGTGGCAAGTGGTCTGTCATATGCCAATTTTTTCATTAACAGTAATGTTGTTCTTGTCATTCTGCTATCGCTACTTACTGTTGGATTTGCATTAATCTGCCTTTACACCTCACAAGAATTCCAGCTCAAAGTTGCAAAATTGTTGACAATCATGTTTGCCCTGTTGATGGCCTATGTGACAGTCGGTGTGGCCGCACAAGCTGCTGATGATTTGTACGAGCGTGAACACCCACCCACTTCCACTCCAGGCCCCGCAACTCACATGTACCCAACACAGAACAATACAAGGTTCACTAAAAGATCTCTGCTAGCTGTAGGCAATTCAAACGTAACTACTGCAGCTCTGGTATCCACTACGGCCATTCTTGACCTTGCTGAACGGCTCCCAGCTGATGTAAGCTCGCTGTATCTGGCGGGTCTGATCGGGATTTTCTTCGTGGCGGCCTTTTTACACCCCACAGAAGCTGGATGTTTGGTACACGGTATATGGTATCTACTGTGCCTTCCATCCGGTTATCTGTTGCTGTTTGTGTACTCTATATGTAACATGACAGATCGCTCATGGGGTACAAGAGAAGAGAAAACCAAGAAAGTGGATGATGTTCCTTGGTATCAGACTCTTTGGACAAAGATGAGGTTTATTTGTACATGTTGTAGACCTGAGCCAGCTCCTCAGCCTCCTGGCGATAGCAGGGTGGATGGACATGCAACTGATTCACCACCATCGTCTGTGGCCTCTACAGAGGAGAATTTCGAATCCGACAATGGCCTACAAGCTTCGGAAGATGAATCCACAATTCTTCCTGCAGCTGATGACTCAAGCACTACACTATTGGACGAGGCGCCACCCAAGTCAGCTATGAAGCAACCGCTAGCACGGCGGACATCTGTACCTCGCGATGGGCAAAAAGAGGACAGTGGCCGTTATCAGTCTAAATGGCGTTACCCTGGTGACAAGAAGGTTACATTCGCTACCAAGCTCCCACGGTTGCATCCTGAAACTGCTGTCGAGGATTGGCTACAAAGAGAGTTTCAGCAACTGTACTCGAACAACTTCAGAGAGTTTGGTTATGATAACGTGGGCTTTATCGCTGGCATGACAGACAAGCAATTAAAAGTCATTGGAATTGAGAAACGTGGTCATCGCAAGAAGCTGTTGATTGAAATCGAGAAGCTCCCTCAGGTGGAAATTCCACAGGAAGTACCGGAAAACATTGAAGATTGGTTAACTGAACTGGGACTTGATGAATACTGGGACAACTTTACCCAGAGTGGCTACACGGAACCAAGGATGTTAGAAGATCTCAAGATTATGAACAAAGAAACGCTAAAAGAGAACTTCAGAATCATCAAACCAGGACACTTGGATAAACTGTACAAGGCCATACAGAAAGTACAGTACCCGACCGAAGCTCAGAGGAGAATTCGTCGCGCTCGTGAAGAAACAAACAAATTGATTGTCATGGATTTAAAGGTGGATAATCAAGACAATGGACTGGAATATCTGTTTTGGGATGGTCTGCGGCAAGCCTGTCTCGTGCCGGAATCAGCCATATTTGGCGCAATTGAGGAACTAAAGGAGAAGCTTGAAGATCTCCGTGACTCGACTCTAATGGTGTTCGCCATTGCAAACGCTATCTGGATCATCCTGATAATGACTCTTGTCCAACAGAAAAACCTGCAATTCTTGGGAACCAACGTCCTGGGTCTCGCATTTCTCTGCATCTACGGCTTACTCATAGTTATACAATTCTTGACTCTCCTATGGCACAGGGGCGTGACGTTTTTCCACGTGATTGCGCGTGCGCCGTGGAGGCGTGGTCCTCTACACATGGTGTGGGCGTTTGATGACCAAAATCTGCCTCCTCCCCCCAATGAACGCGACTTGGAAGCCATCCGAAATAATCGAGACCGGAGACCTCGCAGGCGTCGAAATCAGGAGTACCGTCGGTATTCGAGTCAAGCCGAGCACATCCAGTGA

Transcript

OS493_003489-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8T5G8	Chitin synthase OS=Meloidogyne artiellia OX=42426 PE=1 SV=1
G5EBQ8	Chitin synthase chs-2 OS=Caenorhabditis elegans OX=6239 GN=chs-2 PE=1 SV=1
G5ECD6	Chitin synthase chs-1 OS=Caenorhabditis elegans OX=6239 GN=chs-1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000978 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03142 all species →	Chitin_synth_2	Chitin synthase	Family	Interproscan
PF07647 all species →	SAM_2	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR029044 all species →	Homologous_superfamily	Nucleotide-diphospho-sugar transferases	Interproscan
IPR004835 all species →	Family	Chitin synthase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22914 all species →	CHITIN SYNTHASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004100 all species →	Molecular Function	chitin synthase activity	Interproscan
GO:0006038 all species →	Biological Process	obsolete cell wall chitin biosynthetic process	Interproscan
GO:0016758 all species →	Molecular Function	hexosyltransferase activity	Interproscan
GO:0030428 all species →	Cellular Component	cell septum	Interproscan
GO:0071944 all species →	Cellular Component	cell periphery	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003489-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003489-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

59.4Max TPM

25.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	29.06	42.65
polyp at pH7 6	18	18	25.66	34.43
coral polyp · control treatment	16	16	35.23	59.42
coral polyp · oil and dispersant treatment	16	16	21.05	39.54
coral polyp · oil treatment	16	16	25.07	52.72
coral polyp · dispersant treatment	16	16	26.26	44.70
Polyp	10	10	7.48	10.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.65
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.14
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	38.02
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.32
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.28
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.12
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.92
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.67
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.86
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.04
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.62
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.72
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.81
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.96
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.20
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.43
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.55
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.64
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.63
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.46
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.80
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.74
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.31
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.87
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.22
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.99
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.79
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.32
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.42
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	55.70
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.78
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.60
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.48
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.58
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.00
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.15
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.09
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.61
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.55
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.11
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.78
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.56
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.33
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.17
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.01
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.02
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.49
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.80
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.79
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.64
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.54
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.69
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.72
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.62
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.15
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.09
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.61
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.70
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.89
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.52
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.98
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.99
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.70
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	41.55
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.84
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	37.79
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.05
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.86
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.63
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.93
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.35
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.91
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.19
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.67
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.49
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.14
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.76
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.20
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.00
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.79
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.88
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.10

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.