Gene detail

Detailed information of OS493_003599-T1 in Lophelia pertusa

Genomic Location: scaffold_7:3516465...3543522
NR annotation: KAJ7393930.1, hypothetical protein OS493_003599 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003599-T1

ATGAAAAAATGGATGGTCCTACTTGGCGGGGCCATGTTCTGTGTCCTGTTTTTTTCCATGTACTTGGTAGTGGATCAGTTAGGTCGATTGCCAACCTCTCAAGAAATCTTCAAAGTTGAGATGAAACAGAAAATTGAAGATCCTCTGAATGTTCTTGATAAAGACATGAATAAATTAGAAGGGAATATACAAAGATCTGGTAAAATCATGAGCAGTATGCAAAATACTGTCGAAAAATTAAGATTCCACGGCCACAGACCAGCCACTGAAAAACAAGAGAATGTGGCATTAGTAAGGAGACCTGAAATGCAATCTAGCGATATGGATGATGGCTGTATGTTCTCCGGGACAGCATCAGGAAAATCTGCAAATGTGAAGATGTTAGACATGTTTGATGTGATGCCATTTGACAACGTTGATGGCGGTTCATGGAAACAAGGCTGGGATGTACGATATGATGATAACGCATTTGATAAAGAACCTCTAAATGTGTTTGTGGTCCCTCACTCGCATAATGATCCAGGCTGGGTCAAGACCTTAGATCAGTACTACACACAACAGACTCGACATATTCTCGACAATGTTATTGATGCACTCGCAGAAGACAAAAGGAGAAAGTTTATCTGGGCAGAAATATCGTATTTGTCAATGTGGTGGAAAGATACTGATGATCAAAGAAAAAAGCTTGCTCTAGAGCAACTGTCTAGTGGTCAGTTAGAGATTGTAACAGGTGGATGGGTGATGAATGATGAGGCTAACACCCATTATTATGCCATGCTGGATCAGATGATTGAAGGTCATCAGTGGATTGAAAAAAATCTTGGTTCAGGTGAAGAAGCATCTTGCCAAGGAAAAAATCTTGAATTCATGTGGAGACAAAACTGGGATCATGGATCGTCAACAGACATGTTTTGTCACATGATGCCATTTTACAGCTATGACGTTCCTCACACATGTGGTCCAGAACCAAAGATTTGTTGCCAGTTTGATTTCCGTCGCTTACCGGGTGGTGGTATCAATTGCCCATGGAGAATTCCTCCTGTAAGGATTGACGATAGCAATGTTGGATCAAGAGCCAACTTACTATTAGATCAGTACAAGAAGAAAGCTCAACTTTACAGGACCAATGTCTTGTTTGTTCCCTTGGGAGATGATTTTCGATACGAAACTAAATTTGAAGCACATGAGCAGTACACAAATTATCAGAGACTTATGGACCATATCAATTCTCATCCAGAGCTGAAGGCAAAGATTCAGTTTGGGACTCTGAGTGATTATTTCAATGCAATATGGAAAACCACTGGATCTGAGCCTGGCAGTCAACCAAAAGGCTTCCCAGCTTTGAGTGGAGACTTCTACACTTATGCGGACAGGGATGATCACTACTGGAGCGGATACTACACATCAAGACCATTTTACAAGCACATGGATAGAGCACTGGAATCACATCACAGGGCTGCTGAAATCATTTTCTCCTTGGCTGAATCTCACGCTCGTCATCACGCAAGTTCAACCTTTGCTGTGGAGCAACTGTATGGTCTGCTGACCAATGCACGCCGTAACTTGGGTGTATTTCAACATCATGACGGCATCACTGGCACCGCTAAGGACTTTGTGGTTATTGATTATGCTACAAGGATGCTCCAGTCACTGAATGACATGCAGCGTGTGATACAGGACTCCGCCCATTTTCTGTTGACAACTGACAAGTCACACCACTTGGCACCAGACCCTGTGTTACCTCCTCTTAAGTTTGGAGAAAGCAGATTAGCTCAAGATGCATTGCCAACTAAAGACGTGCTGACATTGTCCAACACACCAAGGCCAGTAGTGTTGTACAATTCCCTGACGACAGCAAGAGAACAAGTGGTCAGTCTTCACATCTCAGAACCAAAAGTCATGGTTAGTGACAGTGAAGGAAAGGAAGTCCCAAGTCAAGTGAACTTATGGTGGGATCACAGAAACAGAATATCAACTGCCAAATATGAAAGTGAATGTTCCAGTATCACCGAGTATAATGCCGCTGGAGAATCTTTAAAACTAAGTGAGGAATTTAAACATGAAGTCAAGCAACCAGGAGCAGAATTCATTATTTTGGAAAATGATCACCTCAAAGTTGAATTTGATAGTCTTCGTGGGCTTTTGAAGAGCATCACTCATAAGAAGGACGGAGCTGTGACGCAAGTGGCTATTGATTTTGTGTCGTATGGTACAAAAGCCTCTGGAGACAGGAGTGGAGCTTATCTGTTTATGCCAAATGGACCTGCCGAGGCTCATGGGATAGGAGAGCAGCCATCTGTGTATGTGAGCAGAGGAAAACTGATGCAAGAAGTACGAGTTGCTCTTCCCAATGTTCTCCACGTGGTCAGAATTTATTCCGTGTCTGGGCCTGAAGGACGAACTCTGGATATTCAAAACAAAGTGGATATACGAAATCAAATAAACAGGGAATTGGTGATGAGAATCAAAAGCAATGTACAAAACAGTGGCCGTGAATTTTATACTGACTTGAATGGATTTCAGATGCAAAAGCGTAAAACACTGGACAAGATTCCCATCCAGGCCAACTTTTACCCTCTCCCATCCATGGCGTTCCTTCAAGATAAGTCCACACGCGATGACAACAGAGGCCTGGGTCAGGGCGTCACGGATAACAAGGTTACCGCAGCTAACTTCAGACTCGTCGTCGAGCGATTTAAAAGTCCACACGAACCTGATGGCATTCCTCTAGCGTACCCCTCCCTCCTTAGTCACCGTTTGTTACACCATCTTAACCACCCACTGTTTACGTTTGTGACTCCGGTCGAGTCCGCGGACTCCGTGAATCTGTTGTCAAATTTCAACAGTCTGCAGTCAGATCTACCTAATGATATCTTCATGGTCACCTTGCGCTCAGTAGCAGATAAACAGCGGCCTCGACCCAGTGGTGAGGCTCTGCTGGTGCTTCATCGTCTGGGATATGATTGTAATTTCGAGTGCAAGTGCCTCGCTACCACGAGCCGAGGACAGGTGAAGTTAAACCATTTATTCAAAGACTTATCGATTGATAAGCTCCAGTCCACCTCTCTGACAATGTTACACGAGTACCAGGAACTGGATCCCAGCTCTCCTCTTAACGTGGATCCAATGGAATTGTATTCATACAAGATGAGGCTCAAGTGA

Transcript

OS493_003599-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P49641	Alpha-mannosidase 2x OS=Homo sapiens OX=9606 GN=MAN2A2 PE=1 SV=3
Q8BRK9	Alpha-mannosidase 2x OS=Mus musculus OX=10090 GN=Man2a2 PE=1 SV=2
P28494	Alpha-mannosidase 2 OS=Rattus norvegicus OX=10116 GN=Man2a1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003720 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF09261 all species →	Alpha-mann_mid	Alpha mannosidase middle domain	Domain	Interproscan
PF01074 all species →	Glyco_hydro_38N	Glycosyl hydrolases family 38 N-terminal domain	Domain	Interproscan
PF07748 all species →	Glyco_hydro_38C	Glycosyl hydrolases family 38 C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015341 all species →	Domain	Glycoside hydrolase family 38, central domain	Interproscan
IPR050843 all species →	Family	Glycosyl Hydrolase Family 38	Interproscan
IPR000602 all species →	Domain	Glycoside hydrolase family 38, N-terminal domain	Interproscan
IPR011330 all species →	Homologous_superfamily	Glycoside hydrolase/deacetylase, beta/alpha-barrel	Interproscan
IPR011682 all species →	Domain	Glycosyl hydrolase family 38, C-terminal	Interproscan
IPR037094 all species →	Homologous_superfamily	Glycoside hydrolase family 38, central domain superfamily	Interproscan
IPR027291 all species →	Homologous_superfamily	Glycoside hydrolase 38, N-terminal domain superfamily	Interproscan
IPR011013 all species →	Homologous_superfamily	Galactose mutarotase-like domain superfamily	Interproscan
IPR013780 all species →	Homologous_superfamily	Glycosyl hydrolase, all-beta	Interproscan
IPR028995 all species →	Homologous_superfamily	Glycoside hydrolase families 57/38, central domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11607 all species →	ALPHA-MANNOSIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004559 all species →	Molecular Function	alpha-mannosidase activity	Interproscan
GO:0006013 all species →	Biological Process	mannose metabolic process	Interproscan
GO:0000139 all species →	Cellular Component	Golgi membrane	Interproscan
GO:0006491 all species →	Biological Process	N-glycan processing	Interproscan
GO:0006517 all species →	Biological Process	protein deglycosylation	Interproscan
GO:0005975 all species →	Biological Process	carbohydrate metabolic process	Interproscan
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0030246 all species →	Molecular Function	carbohydrate binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01231	MAN2; alpha-mannosidase II	EC:3.2.1.114	Various types of N-glycan biosynthesis	ko00513	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003599-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

56.7Max TPM

18.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.43	16.63
polyp at pH7 6	18	18	12.91	16.70
coral polyp · control treatment	16	16	24.14	40.44
coral polyp · oil and dispersant treatment	16	16	33.84	56.68
coral polyp · oil treatment	16	16	18.70	30.12
coral polyp · dispersant treatment	16	16	18.66	35.91
Polyp	10	10	7.77	14.41

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.63
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.71
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.01
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.77
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.73
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.62
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.36
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.37
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.37
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.12
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.90
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.65
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.70
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.66
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.34
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.97
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.97
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.95
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.89
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.87
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.09
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.89
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.80
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.40
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.09
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.44
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.06
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.55
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.37
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.03
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.90
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.43
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.17
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.06
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.32
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.58
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.23
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.68
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.09
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.48
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.37
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.29
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.37
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.22
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.49
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.71
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.23
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.26
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.68
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.29
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.43
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.95
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.33
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.75
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.28
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.87
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.61
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.41
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.62
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.63
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.58
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.91
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.84
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.77
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.28
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.84
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.35
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.11
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.86
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.19
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.36
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.21
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.02
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.26
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	14.41
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	12.02
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	10.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.38
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.32
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.18
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.99

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.