Gene detail

Detailed information of OS493_003656-T1 in Lophelia pertusa

Genomic Location: scaffold_7:4288149...4293241
NR annotation: KAJ7393985.1, hypothetical protein OS493_003656 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003656-T1

ATGGATACTGATACTAGCAGTGCTAGCAGTGCTAGCAGTGAACACGAAGATGCCGCGAGTAGATGTCGCTGGTTTCGCGTGAACTGGAAATGGTGCAAACTGGGAAGCTCGAACCTTGGAATCAACATTCGCTTGAATCCAGTGGTTTCCTTCGTCTCCTCTGCGATTATTTGGGGCTTTGTCGTTTGGTGCATGATCGAACCAGAAGCGGCCAATTCGCATATGGCAGAGTGGAAAACGTGGATCACCCGTACCTTTACCTGGATGTACATTGGTACCCAAGACGCCTGGGCAGTGTTTATTATCGTCCTGTACTTCTCCAAATACGGCAACATGAAACTGGGAAAACCGGATGAAAAACCTGAATTCAAAGACGCGTCGTACTTCACCATGCTGTTTGCCGCTGGCATAGGGATCGGCTTGTTTTACTTCGGAGTAGCTGAACCGGTCTGGCATTACCAGCCTGGACACTATGGAAACCGCTATTTTGACAGGTACACTGATAATCAACGCGCCCAGGACTCCATGAACCTAACTTTATTCCACTGGGGTATTCACGGATGGATCGTGTACGTTGTGGTGGGTCTTCTCCTGGCCTTTGTAGGTTACAGACAAGGACTTCCCATGACCATGCGCTCCTGTATGTACCCCCTCATTGGGGACAAGATTTACGGATGGATGGGCGACGCCATCGATATCATTTCTGTGGTTTGCACCATGTTTGGCGTCTGCACGAGCTTGGGACTGGGCGTAATGCAACTAAACGCTGGCGTCCATCGCTTAAGGAGCACAATAGAAGTCAGCACCTTAAACCAGATTATCATTATCTGGTGTGTAACGGCCTGCGCTACCGTCTCGGTTATCAGCGGTCTGAAAATGGGCATCCGACGCTTAAGCGAAATCTGTTTCGCCTTAGGTGTATTTGTCATGATGCTTGTCTTCTTCATAGATGATCCTTGGCACACACTGAACTTGCTTGTCCAGAGTACTGGTTATTACATGCAGACGATCATTCAGCTTGGCTTTCATACCGATGCTTTCGCTCAACTAGGAAACGCGCCCGATGGAAAGGAGGCCGTGAAATGGATGGACGGTTGGACCATATTCTACTGGGGCTGGTGGATTTCCTGGTCTCCCTTCGTGGGCATGTTCATTGCCAAGATATCGAGAGGCAGAACCATTCGACAGTTTATCAACGCAACACTCACAGCACCCGTCGCCTTCTCAATCTTGTGGTTCAGCGTTTTCGGAGGTGCAGGTTTGAAGATGGAACGAAATGCAGCACTTGCCAACATAACTTGCAATTCACCAATCGGCGGAGCAGCTGCCACTGAGTCTCTTAATGGTTTGTTCCGTCTGTCCTGCCGTAACAAGAACGACATGTGGTTTGACGTGATGAACCAATATGGCGACATGGGAACTTTCCTTTCAGTTCTTTCCCTAATCGGCATCGTCCTTTACTTTGTCACCAGCTCTGACAGTGGCTCCCTTGTGATAGACTGCCTTTCGGCCAATGGCGACCCAAAACCACCTGTCCTTCAGCGTATCTTCTGGGCTCTTACTGAAGGTGCTACCGCCACTGCTCTTCTTTATGTTGGAGGTGATAAAGCGCTGAATGCCCTGCAAACAGTTTCCATTGCGTCTGGGGTTCCCTACACAATCCTACTTTGTTTCATGTGCGTGGCGTTGTGGAGGGCAGTAAAAATAGAAGCTGGAGACCTGGATCCCAATGGCCCACAGTTCACCACTGGCCTTCTGGATGTTCTAAGCACTCCAACTACCGAGAGCGTGTTTAAAGTTTTCCTGAACATCTTTGCACCCTGGTACGCCATGGCAGTTGCAGCTGGAGAGATGGAAAGACCCAAAGGCAAGAAGTGGAGTCACATGTTGATCCTTGCAATACCGTTCTATACTTGGATCGCACTACTGGTTTTGGAATTCGTAGGTTTGGCTTCTGGGATATGTTACGTTGGCTGGACGGTGCTGTTTGGCTTCTTTGCCTATGGCACAGGGATACGCATCTCCATACGAGAGAAGTACGAAATCAACGGGAACATGGTGGAAGACTTCTTTGCAGTGATGGTCCTCTACCCATTTGCTGCCTACCAGATGGAACACCACGTAAACAATTATCAGGCAAGACTGACCAGCGGAGAGCATCATGTTCAGAATGGAAAGCCTGGACATTGTATGTCATACGATAAATCGGAGTCGTGTTGCATTCCTCTTGGAGAGATGGAAAAGTTAGTGGATCCAGACCAGAGACACTCAAACGTTTAA

Transcript

OS493_003656-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q87NG3	Glycine betaine transporter 1 OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) OX=223926 GN=VP1905 PE=1 SV=1
P9WPR6	Uncharacterized transporter MT0942 OS=Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh) OX=83331 GN=MT0942 PE=3 SV=1
P9WPR7	Uncharacterized transporter Rv0917 OS=Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) OX=83332 GN=Rv0917 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000591 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02028 all species →	BCCT	BCCT, betaine/carnitine/choline family transporter	Family	Interproscan
PF04749 all species →	PLAC8	PLAC8 family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018093 all species →	Conserved_site	BCCT transporter, conserved site	Interproscan
IPR000060 all species →	Family	BCCT transporter family	Interproscan
IPR006461 all species →	Family	PLAC8 motif-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR30047 all species →	HIGH-AFFINITY CHOLINE TRANSPORT PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006810 all species →	Biological Process	transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0022857 all species →	Molecular Function	transmembrane transporter activity	Interproscan
GO:0071705 all species →	Biological Process	nitrogen compound transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02168	betT, betS; choline/glycine/proline betaine transport protein	-	Transporters	ko02000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003656-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

74.8Max TPM

9.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.95	7.95
polyp at pH7 6	18	18	4.55	11.94
coral polyp · control treatment	16	16	13.74	35.26
coral polyp · oil and dispersant treatment	16	16	8.37	26.09
coral polyp · oil treatment	16	16	7.61	15.92
coral polyp · dispersant treatment	16	16	17.98	74.76
Polyp	10	10	6.95	15.13

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.56
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.26
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.90
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.85
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.77
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.29
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.24
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.90
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.03
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.94
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.91
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.80
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.34
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.41
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.68
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.67
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.59
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.45
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.26
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.38
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.26
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.05
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.18
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.26
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.95
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.39
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.04
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.03
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.36
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.50
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.50
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.32
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.32
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.71
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.45
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.44
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.61
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.93
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.21
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.87
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.58
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.92
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.88
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.72
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.11
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.96
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.18
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.07
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.64
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.20
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.74
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.49
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.37
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.76
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.44
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.68
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.10
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.00
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.89
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.62
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.88
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.17
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.92
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.31
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.21
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.83
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.13
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.92
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.24
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.97
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	5.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.52
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.44
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.58

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.