Gene detail

Detailed information of OS493_003657-T1 in Lophelia pertusa

Genomic Location: scaffold_7:4296217...4307649
NR annotation: KAJ7393986.1, Fibronectin type 2 domain [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003657-T1

ATGAATATCGTGGTGATTTTGCTGCTATCAGCGTTGTCATACTCCGCTGCAAATGTTTGCAACACTGTACAGACAGAAGATGGTGGTTGCTGTACTTTCCCTTTCGTGTTTGCTGGTTATTCGTTTGGCGCATGCACCGATTACGGATATACTCCTGGAATAGAATGGTGCAGTTTGACGGATAGTTATGACAGGGATGGACAGTGGGGAATTTGTAAAGTGACAACAGCCGCTCCTCCTCCGCCAACGACTTCAGGTGGTGGATCATCTTCAGGTGGCAGCTGCGGTTCCAAGCCCGGAAGTTCACGTATCGTGGGTGGTTCTTCTGCTAGCCAAATTGTTGTGAGCAATGTGCCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCGTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTTCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGTCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTTCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCGTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCCTAACAGCAATGTGCAGTACTAG

Transcript

OS493_003657-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000120 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00040 all species →	fn2	Fibronectin type II domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036943 all species →	Homologous_superfamily	Fibronectin type II domain superfamily	Interproscan
IPR000562 all species →	Domain	Fibronectin type II domain	Interproscan
IPR013806 all species →	Homologous_superfamily	Kringle-like fold	Interproscan
IPR052949 all species →	Family	Peptide antibiotic immunity-related	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42999 all species →	ANTIBIOTIC RESISTANCE PROTEIN MCBG	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_003657-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003657-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003657-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

108.2Max TPM

28.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	28.46	50.47
polyp at pH7 6	18	18	30.35	56.97
coral polyp · control treatment	16	16	31.28	76.44
coral polyp · oil and dispersant treatment	16	16	28.16	53.88
coral polyp · oil treatment	16	16	42.47	108.19
coral polyp · dispersant treatment	16	16	24.56	97.94
Polyp	10	10	2.89	6.88

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.47
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.87
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.03
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.88
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.09
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.37
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.99
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.22
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.14
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.80
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.44
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.23
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.20
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.66
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.26
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.97
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	56.39
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.92
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.06
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.24
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.65
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.83
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.02
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.81
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.13
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.87
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.47
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.84
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	76.44
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.27
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.90
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.08
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.60
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.79
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.03
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.05
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.02
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.84
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.69
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.96
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.88
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.20
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.70
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.58
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.37
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.65
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.37
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.93
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.86
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.62
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.38
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.56
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.37
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.40
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	108.19
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	99.61
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	70.47
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.00
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.47
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.29
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.43
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.27
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.88
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.43
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.76
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.32
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.11
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.04
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	97.94
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.52
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.77
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.07
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.24
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.31
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.53
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.77
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.51
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.34
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.80
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.91
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.88
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.04
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.59
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.03
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.77
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.47
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.55
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.31
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.60

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.