Gene detail

Detailed information of OS493_003681-T1 in Lophelia pertusa

Genomic Location: scaffold_7:4714814...4729491
NR annotation: KAJ7394009.1, Paired amphipathic helix protein Sin3a [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003681-T1

ATGAGTAAATATGCTGAGCTGTTCCAATGGTTCAAGGAATTTCTTGGCTACAAGGACTCCTCTCCTATGGAGAGTGTGGCTAGTTTCAAGGAAAGAACTTCGGGAGAATTGCATCATCTTGAAATAGACTACTCTTCGTGCAAGAGATATGGTACAAGTTATAGAGCTCTTCCCAAAAGCTACACGCAGCCTAAATGTAGCGGACGCACAGCGCTGTGTAGAGAAGTCCTCAATGACACGTGGGTGTCCTTTCCATCATGGTCAGAAGATACACCTTTTCCGGGAACAAGAAAAACTCAATATGAAGAGTACATTTTTAGATGCGAGGATGAACGATTTGAGTTGGATGTTGTGTTAGAATCCAACCTTTCTACTATTCGGGTTTTAGAAGCTATACAGAAAAAGCTCCAAAGAATGCCAGCTGAAGAGCAAGCAAAGTTCAGACTTGATAGCTGTATAGGAGGAACATCAGAATTTATCCACAGAAAAGCTATCCAGAGGATATATGGTGACAAAGCTCCCGATATTGTTGATGGTTTAAAGAAAACACCCGCAGTGGCTGTGCCGCTAGTACTAAAGAGGTTAAAGACAAAAGAGGAGGAGTGGAGAGAATCTCAAAGGCAGTTCAATAAAATTTGGAGAGATCAAAATGAAAAATATTATCTTAAGTCTTTGGACCATCAAGGGATCACTTTTAAACAAAACGACTTGAAGGCTATGAGATCAAAAAGTTTGATAAATGAGATTGAGAGTATTTATGACGAGAGACAAGAACAGGCCGCTGAAGGTAATGGAGATGCCATGGGCCCTCACCTGGTTTATAACTACCAGGACAAGTCTATTCTGGATGATGCGGCTGGTCTGATTGTTCATCACATGAAGAGACAGACGAGTATTCACAAGGAGGACAAAGCCAGGATTAAAGTTCTTTTGCACTGCTTCTTACCCGACTTGTTCTTTGCTCCAAGGGGTGAGCTGAGTGATGATGAAGACTCTGTTAAGGAACTAAATGGTCTTGGAAAACCTGAACTTACCAATGGGTTACCCGAGGCAGAAGCGGATGATGCATATAACTTAATATATGTAAACAACAACTGGTATTTACTCTTCAGACTTCACCAGATGCTGTCTGAGAGGCTGTTGAGGATGTATCAACAGTCTGTTATGATAGCTGAAGGTGAAGCATGTGACAAGCAGCAGAGAAAACAGGCGACAGCCATTGCGCTGAGATTGAAGGCACCCAGCGAGATAGACCTTGAAGAATACTACCCTGCATTTCTTGACATGATAAGAAACTTACTGGATGGTAACATGGATTCTACAAACTTTGAGGATACTTGTCGCGAGATGTTTGGTGTGCATGCTTACATTGCATTCACTATGGACAAATTAGTTCAAAACATCGTTAGACAGCTGCACACCATTGTAACAGATGAGTCGTGCGGTCAGGTCAGTGAACTGTACCAGCAGGAGCAAGGTAACCTGGCCACTGGAGGAAGCTCGGCCACGCAGCACACCCGTATTTTGTCAGAAGCCGCTTATCAGAAGAGATCCGAGTCGCTGCTGACGGATGAGAACTGTTACAAAGTAGTCATTCACAAAGACAAGAATATCTGCAGGCTGAGCCTGGAGTTACTTGATACAGAGGACACTCAATCAGAGGATCCAGTAGAAGTGGAGAAATGGAATGAATACGTTGAAAAGTTTGTTGGCAGCGAAGAGGTGTCCACGGAAGTCAAGGATCATTTACAGAACAAACCCATATTCTTACCAAGGACGGTGCGTTCCAACGCACGGCTGAAATCCTCCATCACCCCCAGCACTGAGAAGGAATCGACGACAAACGACAATGGTTCTTCTACTGACGAAGCTGAGAGCGAGGGAAATAACAGCGACAAAGAGGAGGATAATGACGAGGTGGAGGACATGGAGGTGGAGAACTCGATGGAATGCAAGCTGAGCTTGAACTCGTACAAGATTCGCTTTGTTAAAGGGAGCGAAGACTACTTGTACAGACGGCAAGCTTTGAAAAGAGCAAAAGAGTGTCATCATGTGGTGGCCAACCGTCTTCACTCCAGATTTCAGGCGTGGTTAAGCGACTGGGTGAAGAGTAACGTGACAAACGACCAGGAGAGCGGCTGTCGTGACTGGCTCCTTGGGCATGTGGAGGGTCTTCACCCTTGCACAACGACCTGCGAGTCGGTCACCAACACCGCCATCCAACACAACAAATACTCCGTCAAGTGGGAGAAGAACTGGAACAGCGTACAAGAACAGGAGGAGGTCGACGACGAGAACATGGAGGGGCGAGGGAGCAGAATGCTGCCACGTCATAAAACACTTTATGTACAGTTCTTATCATTAAACGTATTTCATAGGTATAAAGCTAGTGTAGAACGGTCAGGGGATGGCGTGACAATGTGTCTAAAGAAAACGTGA

Transcript

OS493_003681-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96ST3	Paired amphipathic helix protein Sin3a OS=Homo sapiens OX=9606 GN=SIN3A PE=1 SV=2
Q60520	Paired amphipathic helix protein Sin3a OS=Mus musculus OX=10090 GN=Sin3a PE=1 SV=3
Q62141	Paired amphipathic helix protein Sin3b OS=Mus musculus OX=10090 GN=Sin3b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003099 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08295 all species →	Sin3_corepress	Sin3 family co-repressor	Domain	Interproscan
PF16879 all species →	Sin3a_C	C-terminal domain of Sin3a protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039774 all species →	Family	Transcriptional regulatory protein Sin3-like	Interproscan
IPR013194 all species →	Domain	Histone deacetylase interacting domain	Interproscan
IPR031693 all species →	Domain	Sin3, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12346 all species →	SIN3B-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000118 all species →	Cellular Component	histone deacetylase complex	Interproscan
GO:0000122 all species →	Biological Process	negative regulation of transcription by RNA polymerase II	Interproscan
GO:0000785 all species →	Cellular Component	chromatin	Interproscan
GO:0003714 all species →	Molecular Function	transcription corepressor activity	Interproscan
GO:0016580 all species →	Cellular Component	obsolete Sin3 complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_003681-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003681-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

152.2Max TPM

69.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	56.79	82.88
polyp at pH7 6	18	18	56.99	77.97
coral polyp · control treatment	16	16	92.20	152.15
coral polyp · oil and dispersant treatment	16	16	102.48	145.91
coral polyp · oil treatment	16	16	73.44	101.34
coral polyp · dispersant treatment	16	16	65.66	90.73
Polyp	10	10	26.17	46.64

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	82.88
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	81.75
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	78.29
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	76.25
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	68.31
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.42
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	65.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.48
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.17
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.33
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.49
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.24
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.59
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.80
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.85
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.62
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.97
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.37
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	70.22
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.95
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	68.86
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.77
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.98
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.29
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.67
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.61
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.41
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.58
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	152.15
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	116.92
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	116.75
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	114.21
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	105.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	104.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	103.06
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	100.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.13
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	77.51
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.40
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.17
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	73.14
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.86
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	145.91
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	139.36
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	124.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	122.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	120.24
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	112.81
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	103.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	98.52
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.62
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	96.22
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	94.98
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	87.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	86.99
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	82.15
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.07
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	101.34
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	98.31
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	88.20
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.48
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.30
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	82.39
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	81.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	78.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	77.23
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	76.27
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.59
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.48
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.42
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.45
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	90.73
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.41
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	78.90
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.54
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	76.10
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	75.15
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.49
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.23
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.14
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	70.88
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.08
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.47
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.31
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.31
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.13
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.76
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	46.64
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	39.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	36.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	31.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	24.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	21.06
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	16.64
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	16.58
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	15.42
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.93

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.