Gene detail

Detailed information of OS493_003728-T1 in Lophelia pertusa

Genomic Location: scaffold_7:5295422...5322316
NR annotation: KAJ7394055.1, hypothetical protein OS493_003728 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_003728-T1

ATGAAGTGGCTTTCTATGGCGCTGGGGGGAATTACACAAAGTAAGAGAAACACTTTCCAGGCGGTTCTGATTACAAACGGAAGACATTCTTTTGTTATTTTCAATTATAACAAAATCACGTGGACAACTGGTACGGCCAGTTCAGGGAACAACTCAGGGCTCGGAGGTACCCCGGCACAGGCAGGCTTCAATGCTGGTGATGGTAGAAGATATTTTAGTATCCCAGGATCTCGTACCCATCAAGTTATTAACCTTCCAAGCAAGTCCAATGTGGAGAATCCCGGTCGGTGGATGTTCCGTATTGACAGCGCGATGATCGAGGCTGGTGGCTGTAACACCAAAGGATCGCTCGTGGTTTCACCGCGTTCAGTGATGATGCTTGGTGGTAATAGTCTTTTCATAGCTGGACCGTGCTACAAACCATCCGATGTTATCATTTGTGAATTTCCTGGCGGGAAAGTGAGCAACGGAAGTTTTATCAGCAGCATCCGGGCATCTTGTACCGTACCCATGCTTTACGTGACTGGCAGGCTGTCAATCAAAATGTCGGTCAATGGAGGAAATAGTTTCGATTTTCAAGGGACTATTACAATTGTAAACATCAACAGGATCAAGCCTCATGTTGTTAGACTGATGGCAAACACGTGGTTTGAACAACGTCAACTCCGGGTCACGTGGGATCCAAGTCACCTTGGAAGTGAGAACCAGACTGTGACTGTTCAATTGGCGCGCTTTTCTATGACGAACGGTCACGTGACTTTTGACAGCGTGTTCACGTTAGTACCAGAGCAGGAGAACACAGGAGACTGTCGATTTATTGTACCTAAAGGAGAAGGCCATGGTGCTGCTATTGGGGATGGTCGTTACGTTACACTGGTGTTAGTGAAAAAGACTGGTGACAGACACGGCAATTCCCCGACCGAGTGGATCTGGAGCGATCTGTTTACCTGGAGAACCAATGATGAGAGGGGTCACGAGAGATGCATGCACTGGTACAGAAAGCAGCCTAATCCAAACATATATACAGATGACGCTTCCCTCTTTCCTTGTCCACAAACGTTTCTGCAAGCAATGGCGGACCGTGGGCGATTCACGATGGATGAATATTGTAATCCAAATGCCGAGGAAAACTGTGACCGTTATCATTATGAAGCGACGCACTGCTTCAGGACAAACATTCCAAGTAACCAAGGTGCAGGACAGCAATGCTGCTACAATAAGCAAGGAAACTTAATGATTGGTCCGCTAAATGGAGGATCCCTGGATCGAGTTCATATTGAAGCGGGAGTACCAGTCTTCTCTCATTTCTTTCACGATCTTGTGCCTTATTTGGATTGCTGTCTGTTTTCTGAGAACTGCAAAAAGTATTTTGAGAAAAGACCTTCAGATGACGGCTCAAATTACGAACCACCAAGACCAGCCACTGGTTTCGGCGACCCTCACATGATTACCCTTGATGGAGTGGAATACACATTCAATGGTTACGGCGACTATCAAATCCTCCAGGTAGCCGCCCCTGACTTCAAACTCCAGGGACGAATGCAGCCCTTGATCAACAATGATGGCAGCAATACTCGTGCTACAAGTTATAAAGCGTTTGCAATGAAAGAAAATGGCTCAGATACTGTACAGGTTCACATCAATGGTCGCAACGAAATAGAAGTTTTGGTAAATGGAGATCTGACGGAATTTGATGAGGAATTGATGGTGGATTTTAACGGCGTCATCGTTTTAAAATACAACAACACATCTAAATACTCCACCATATTTAATTCTGGAATATCAGTCACTATTGAAAAAGTGGAGGACATTTTACAAATGATACTATTGGTACCACCAATGTTTAAGGGAAACACAAGTGGCCTTCTTGGATTGTGGGACGGAGATCAGGAAAAGGAATTCCTGCTTCCCAAAGGAACCTTTCTGGACACTAATTCAAGCCAGACCATAATTCACTACAAGTTTGGACAGACATGGGCGACAACTGCCAACGATTCGTTATTTACTTACGAGGAAGGCAAAAATCATAATTCTTATGTCGATGTCGGATACGTGCCGATATTTTTGGATCAGGATGACTTGGTGTTTGATAACGCAGGCCTGGGTCAGCAGGCTCGTGACGTGTGTGGTGATAACAAGCAATGTCTGTTTGATATTCACACCACTGGAAAGGTCAGCATTGGAATGGCTTCCAAGCAGGCGGTGGAATTGTTTGTTGCAGTTATCAATGAGACTGAAACACCAGGTTGCATACCAATAGAAAACAGACTTCAAAATGGTTCAGTGCAAAGAAACGATTCTAAAGATGGAGGAATGATCTACAAATTCCGCTGTAACTCAGGTTTCCGTCTCAACGGCCCTACAGTCATTCATTGTTATCAAGGACAATGGAATGGCTCTAAACCAAGTTGTGAGCCATCAGCAGATAACAGCACGCCCTGGTATGTTTACGCTGTAGTGATTTCATCCGCCATAGTAGTGGTCATTGTGGCTGTCATGATCATTTCAGTCAGATGTTTGAACAGCAAGCGGAAACGCAATTGGGTCGTCGATATCACGCAACCCCCAAAAAGGCGCGATGTCCTAAGCTGTGACAACGGCGGAGGAGATTATCTAACTGAAAACCAAGAACTTAATGTAGTCGAAATTTAG

Transcript

OS493_003728-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9UGT4	Sushi domain-containing protein 2 OS=Homo sapiens OX=9606 GN=SUSD2 PE=1 SV=1
H9JIQ1	Protein mesh OS=Bombyx mori OX=7091 PE=1 SV=1
P34501	Defecation cycle abnormal dec-7 OS=Caenorhabditis elegans OX=6239 GN=dec-7 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000637 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06119 all species →	NIDO	Nidogen-like	Family	Interproscan
PF00084 all species →	Sushi	Sushi repeat (SCR repeat)	Domain	Interproscan
PF03782 all species →	AMOP	AMOP domain	Domain	Interproscan
PF00094 all species →	VWD	von Willebrand factor type D domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR051495 all species →	Family	Epithelial Barrier and Cell Signaling Protein	Interproscan
IPR003886 all species →	Domain	NIDO domain	Interproscan
IPR001846 all species →	Domain	von Willebrand factor, type D domain	Interproscan
IPR000436 all species →	Domain	Sushi/SCR/CCP domain	Interproscan
IPR005533 all species →	Domain	AMOP domain	Interproscan
IPR035976 all species →	Homologous_superfamily	Sushi/SCR/CCP superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13802 all species →	MUCIN 4-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan
GO:0007160 all species →	Biological Process	cell-matrix adhesion	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23820	SUSD2; sushi domain-containing protein 2	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_003728-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

27.5Max TPM

10.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.18	22.98
polyp at pH7 6	18	18	9.75	16.34
coral polyp · control treatment	16	16	13.07	25.28
coral polyp · oil and dispersant treatment	16	16	8.13	20.88
coral polyp · oil treatment	16	16	10.75	27.50
coral polyp · dispersant treatment	16	16	9.97	22.52
Polyp	10	10	5.66	13.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.98
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.43
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.20
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.01
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.43
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.26
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.19
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.16
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.70
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.94
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.42
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.03
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.59
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.69
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.34
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.69
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.45
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.37
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.93
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.46
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.03
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.76
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.56
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.57
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.28
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.63
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.22
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.02
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.52
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.92
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.65
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.02
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.20
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.10
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.84
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.32
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.21
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.88
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.70
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.58
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.05
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.72
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.59
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.64
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.76
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.14
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.26
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.50
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.16
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.25
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.17
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.28
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.33
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.31
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.14
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.51
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.28
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.15
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.89
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.45
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.87
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.52
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.03
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.20
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.57
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.90
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.14
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.72
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.55
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.63
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.74
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.28
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	7.70
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.77
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.04
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.22
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.82
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.44
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.51

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.